ID: 976205282

View in Genome Browser
Species Human (GRCh38)
Location 4:82618322-82618344
Sequence GAGTGACAAGTTTGGATTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976205276_976205282 -2 Left 976205276 4:82618301-82618323 CCAGTAAGCCCAGTTCCCAGTGA No data
Right 976205282 4:82618322-82618344 GAGTGACAAGTTTGGATTCCAGG No data
976205275_976205282 8 Left 976205275 4:82618291-82618313 CCTGGGAAGGCCAGTAAGCCCAG No data
Right 976205282 4:82618322-82618344 GAGTGACAAGTTTGGATTCCAGG No data
976205271_976205282 30 Left 976205271 4:82618269-82618291 CCTCTTCAGAGCACACATCAGGC No data
Right 976205282 4:82618322-82618344 GAGTGACAAGTTTGGATTCCAGG No data
976205277_976205282 -10 Left 976205277 4:82618309-82618331 CCCAGTTCCCAGTGAGTGACAAG No data
Right 976205282 4:82618322-82618344 GAGTGACAAGTTTGGATTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976205282 Original CRISPR GAGTGACAAGTTTGGATTCC AGG Intergenic
No off target data available for this crispr