ID: 976208593

View in Genome Browser
Species Human (GRCh38)
Location 4:82645033-82645055
Sequence AGGTGTGAGCCACCGGTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3274
Summary {0: 7, 1: 42, 2: 157, 3: 657, 4: 2411}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976208593_976208599 5 Left 976208593 4:82645033-82645055 CCAGGCACCGGTGGCTCACACCT 0: 7
1: 42
2: 157
3: 657
4: 2411
Right 976208599 4:82645061-82645083 TCCGGCACTTTGGAAGGCCAAGG 0: 3
1: 283
2: 8816
3: 103628
4: 224011
976208593_976208596 -5 Left 976208593 4:82645033-82645055 CCAGGCACCGGTGGCTCACACCT 0: 7
1: 42
2: 157
3: 657
4: 2411
Right 976208596 4:82645051-82645073 CACCTGTAATTCCGGCACTTTGG 0: 23
1: 3804
2: 81357
3: 218318
4: 255724
976208593_976208604 23 Left 976208593 4:82645033-82645055 CCAGGCACCGGTGGCTCACACCT 0: 7
1: 42
2: 157
3: 657
4: 2411
Right 976208604 4:82645079-82645101 CAAGGTGGAAGGATCACTTAAGG 0: 6
1: 139
2: 1666
3: 9452
4: 33347
976208593_976208605 28 Left 976208593 4:82645033-82645055 CCAGGCACCGGTGGCTCACACCT 0: 7
1: 42
2: 157
3: 657
4: 2411
Right 976208605 4:82645084-82645106 TGGAAGGATCACTTAAGGTCAGG No data
976208593_976208601 8 Left 976208593 4:82645033-82645055 CCAGGCACCGGTGGCTCACACCT 0: 7
1: 42
2: 157
3: 657
4: 2411
Right 976208601 4:82645064-82645086 GGCACTTTGGAAGGCCAAGGTGG 0: 40
1: 2965
2: 63773
3: 153157
4: 160108
976208593_976208598 -1 Left 976208593 4:82645033-82645055 CCAGGCACCGGTGGCTCACACCT 0: 7
1: 42
2: 157
3: 657
4: 2411
Right 976208598 4:82645055-82645077 TGTAATTCCGGCACTTTGGAAGG 0: 4
1: 705
2: 25566
3: 326488
4: 261857
976208593_976208602 12 Left 976208593 4:82645033-82645055 CCAGGCACCGGTGGCTCACACCT 0: 7
1: 42
2: 157
3: 657
4: 2411
Right 976208602 4:82645068-82645090 CTTTGGAAGGCCAAGGTGGAAGG 0: 52
1: 2206
2: 28156
3: 83347
4: 161118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976208593 Original CRISPR AGGTGTGAGCCACCGGTGCC TGG (reversed) Intronic
Too many off-targets to display for this crispr