ID: 976208594

View in Genome Browser
Species Human (GRCh38)
Location 4:82645040-82645062
Sequence GAATTACAGGTGTGAGCCAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 8087
Summary {0: 38, 1: 888, 2: 2247, 3: 2738, 4: 2176}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976208594_976208602 5 Left 976208594 4:82645040-82645062 CCGGTGGCTCACACCTGTAATTC 0: 38
1: 888
2: 2247
3: 2738
4: 2176
Right 976208602 4:82645068-82645090 CTTTGGAAGGCCAAGGTGGAAGG 0: 52
1: 2206
2: 28156
3: 83347
4: 161118
976208594_976208601 1 Left 976208594 4:82645040-82645062 CCGGTGGCTCACACCTGTAATTC 0: 38
1: 888
2: 2247
3: 2738
4: 2176
Right 976208601 4:82645064-82645086 GGCACTTTGGAAGGCCAAGGTGG 0: 40
1: 2965
2: 63773
3: 153157
4: 160108
976208594_976208605 21 Left 976208594 4:82645040-82645062 CCGGTGGCTCACACCTGTAATTC 0: 38
1: 888
2: 2247
3: 2738
4: 2176
Right 976208605 4:82645084-82645106 TGGAAGGATCACTTAAGGTCAGG No data
976208594_976208599 -2 Left 976208594 4:82645040-82645062 CCGGTGGCTCACACCTGTAATTC 0: 38
1: 888
2: 2247
3: 2738
4: 2176
Right 976208599 4:82645061-82645083 TCCGGCACTTTGGAAGGCCAAGG 0: 3
1: 283
2: 8816
3: 103628
4: 224011
976208594_976208598 -8 Left 976208594 4:82645040-82645062 CCGGTGGCTCACACCTGTAATTC 0: 38
1: 888
2: 2247
3: 2738
4: 2176
Right 976208598 4:82645055-82645077 TGTAATTCCGGCACTTTGGAAGG 0: 4
1: 705
2: 25566
3: 326488
4: 261857
976208594_976208604 16 Left 976208594 4:82645040-82645062 CCGGTGGCTCACACCTGTAATTC 0: 38
1: 888
2: 2247
3: 2738
4: 2176
Right 976208604 4:82645079-82645101 CAAGGTGGAAGGATCACTTAAGG 0: 6
1: 139
2: 1666
3: 9452
4: 33347

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976208594 Original CRISPR GAATTACAGGTGTGAGCCAC CGG (reversed) Intronic
Too many off-targets to display for this crispr