ID: 976208597

View in Genome Browser
Species Human (GRCh38)
Location 4:82645053-82645075
Sequence TTCCAAAGTGCCGGAATTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 608521
Summary {0: 4, 1: 699, 2: 25053, 3: 323237, 4: 259528}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976208597_976208604 3 Left 976208597 4:82645053-82645075 CCTGTAATTCCGGCACTTTGGAA 0: 4
1: 699
2: 25053
3: 323237
4: 259528
Right 976208604 4:82645079-82645101 CAAGGTGGAAGGATCACTTAAGG 0: 6
1: 139
2: 1666
3: 9452
4: 33347
976208597_976208602 -8 Left 976208597 4:82645053-82645075 CCTGTAATTCCGGCACTTTGGAA 0: 4
1: 699
2: 25053
3: 323237
4: 259528
Right 976208602 4:82645068-82645090 CTTTGGAAGGCCAAGGTGGAAGG 0: 52
1: 2206
2: 28156
3: 83347
4: 161118
976208597_976208605 8 Left 976208597 4:82645053-82645075 CCTGTAATTCCGGCACTTTGGAA 0: 4
1: 699
2: 25053
3: 323237
4: 259528
Right 976208605 4:82645084-82645106 TGGAAGGATCACTTAAGGTCAGG No data
976208597_976208606 26 Left 976208597 4:82645053-82645075 CCTGTAATTCCGGCACTTTGGAA 0: 4
1: 699
2: 25053
3: 323237
4: 259528
Right 976208606 4:82645102-82645124 TCAGGAGTTCAAGAGCAGCCTGG 0: 838
1: 55530
2: 127576
3: 174600
4: 194637

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976208597 Original CRISPR TTCCAAAGTGCCGGAATTAC AGG (reversed) Intronic
Too many off-targets to display for this crispr