ID: 976208602

View in Genome Browser
Species Human (GRCh38)
Location 4:82645068-82645090
Sequence CTTTGGAAGGCCAAGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274879
Summary {0: 52, 1: 2206, 2: 28156, 3: 83347, 4: 161118}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976208593_976208602 12 Left 976208593 4:82645033-82645055 CCAGGCACCGGTGGCTCACACCT 0: 7
1: 42
2: 157
3: 657
4: 2411
Right 976208602 4:82645068-82645090 CTTTGGAAGGCCAAGGTGGAAGG 0: 52
1: 2206
2: 28156
3: 83347
4: 161118
976208597_976208602 -8 Left 976208597 4:82645053-82645075 CCTGTAATTCCGGCACTTTGGAA 0: 4
1: 699
2: 25053
3: 323237
4: 259528
Right 976208602 4:82645068-82645090 CTTTGGAAGGCCAAGGTGGAAGG 0: 52
1: 2206
2: 28156
3: 83347
4: 161118
976208594_976208602 5 Left 976208594 4:82645040-82645062 CCGGTGGCTCACACCTGTAATTC 0: 38
1: 888
2: 2247
3: 2738
4: 2176
Right 976208602 4:82645068-82645090 CTTTGGAAGGCCAAGGTGGAAGG 0: 52
1: 2206
2: 28156
3: 83347
4: 161118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976208602 Original CRISPR CTTTGGAAGGCCAAGGTGGA AGG Intronic
Too many off-targets to display for this crispr