ID: 976209256

View in Genome Browser
Species Human (GRCh38)
Location 4:82651129-82651151
Sequence TGTCTCACACAGATGGTAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 234}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976209256 Original CRISPR TGTCTCACACAGATGGTAGT TGG Intronic
901133127 1:6975187-6975209 AGGCTCACACTGATGGTGGTGGG - Intronic
901159107 1:7161595-7161617 TGTCTTACATGGATGGTAGCAGG - Intronic
902952139 1:19893450-19893472 TGTCACACACAGATGCTATGAGG - Intronic
906165068 1:43680000-43680022 AGGCTCACACAGCTGCTAGTTGG + Intronic
906772057 1:48494117-48494139 TGCCTGACACTGTTGGTAGTTGG + Intergenic
909550998 1:76898149-76898171 GGTCTCACACAGATGGGATACGG + Intronic
911900766 1:103500601-103500623 TGCCTTACACAGTTGGGAGTAGG + Intergenic
912121821 1:106480451-106480473 TGTCTTACATAGATGGTGGCAGG - Intergenic
912249038 1:107991822-107991844 TGATTCACACAAATGGTATTTGG + Intergenic
912364641 1:109122929-109122951 TGTCTCACAAAAAAGGTAGGGGG + Intronic
914733479 1:150393675-150393697 TGTCTCTTACGGAAGGTAGTGGG + Intronic
915523374 1:156461761-156461783 GGCCTCACTCAGATGGTGGTTGG + Intergenic
916391420 1:164334799-164334821 TCTCTCATACAGAAGGTACTTGG + Intergenic
916947404 1:169742670-169742692 TGTCTTACATAGATGGCAGCAGG + Intronic
917690460 1:177463045-177463067 TGTCTTACATGGATGGCAGTAGG + Intergenic
918969534 1:191396795-191396817 TGTCTTACACGGATGGTGGCAGG - Intergenic
921122770 1:212151038-212151060 TGTCTCTCTCAGATGATAATTGG - Intergenic
922196807 1:223365474-223365496 TCTCACATACTGATGGTAGTTGG + Intergenic
922530711 1:226342858-226342880 TGTCTTACATGGATGGTAGCAGG - Intergenic
923515524 1:234694916-234694938 TGTCTCAAACAGATGTGAGAAGG + Intergenic
923757984 1:236811124-236811146 CGTCTTACACGGATGGTAGCAGG + Intronic
1067213486 10:44281323-44281345 TGTCTCACACAGATGCCACGTGG - Intergenic
1067761987 10:49055328-49055350 TGTCTGACACAGATGGAGGGAGG + Intronic
1068254528 10:54492963-54492985 TGTCTTACATAGATGGCAGCAGG + Intronic
1068908192 10:62350896-62350918 TGTCTTACATGGATGGTAGCAGG + Intergenic
1069189161 10:65466078-65466100 TGTCTTACATGGATGGTGGTGGG - Intergenic
1069805332 10:71118906-71118928 TGTCTTACATAGATGGCAGCAGG - Intergenic
1071205537 10:83271879-83271901 TGGGTCACCCAGATGGCAGTAGG + Intergenic
1073831199 10:107385297-107385319 GCTCTCACCCAAATGGTAGTTGG + Intergenic
1073991121 10:109263022-109263044 AGTCCCACACAAATGGTTGTCGG + Intergenic
1075209885 10:120481961-120481983 TGTCTTACATGGATGGTAGCAGG - Intronic
1075941055 10:126390234-126390256 TGTCTTACATGGATGGTAGCAGG - Intergenic
1076076973 10:127541499-127541521 GGTCTCACACTGATGTTAGGAGG + Intergenic
1076447951 10:130531388-130531410 TGTATCCCAGAGATGGTGGTGGG + Intergenic
1077068820 11:657893-657915 TGTCTCCCACAGGTGGCAGCGGG + Intronic
1078405906 11:11069732-11069754 TGTCTCCCACAGCTGTAAGTTGG - Intergenic
1082879443 11:58023920-58023942 TGCCACACAGAGATGGTAGAGGG + Exonic
1086145103 11:83543147-83543169 TGTCTCCCAGAGATGGAATTTGG + Intronic
1087408050 11:97754025-97754047 TGTCTCAGACACATTGTACTTGG + Intergenic
1088001770 11:104890513-104890535 TGTCTCTCCCAGATGGTGCTGGG - Intergenic
1090087959 11:123667725-123667747 CGTCTTACACAGATGGCAGCAGG - Intergenic
1092422655 12:8345451-8345473 TGTCTCACATGGATGGCAGCAGG + Intergenic
1093361763 12:18237854-18237876 TGGCTCACACTGGTGTTAGTGGG + Intronic
1095600338 12:44005893-44005915 TGTCTTACACAGATGGCAGCAGG - Intronic
1098493960 12:71113336-71113358 TGTCTTACATGGATGGCAGTGGG + Intronic
1099501336 12:83418021-83418043 TGTCTTACATAGATGGCAGCAGG - Intergenic
1099812666 12:87604843-87604865 TGTCTCACATGGATGGCAGCAGG + Intergenic
1102692253 12:114770526-114770548 TCTCTCCCCCAGATGGCAGTGGG - Intergenic
1103348658 12:120267517-120267539 TGTTCCACACAGCTGGGAGTGGG - Intergenic
1103445228 12:120990073-120990095 TGTCACACATAGATGGAGGTTGG - Intronic
1106934101 13:34699296-34699318 TGTTTCACACAGATGTTGATTGG + Intergenic
1107842453 13:44473009-44473031 CGTCTTACATAGATGGCAGTAGG + Intronic
1108908061 13:55504001-55504023 TATCTCACAGAGTTGGTATTTGG - Intergenic
1109890484 13:68605410-68605432 TGTCTTACATAGATGGCAGCAGG - Intergenic
1110740698 13:78992332-78992354 TGTCTTACATAGATGGCAGCAGG + Intergenic
1111178321 13:84628049-84628071 TGTTTCACTCAGATGATAGAAGG - Intergenic
1111366980 13:87260338-87260360 TGTCTAACAGAGAGGGTAGTTGG + Intergenic
1111551582 13:89819311-89819333 TGTCTTACATGGATGGTAGCAGG - Intergenic
1112289033 13:98128727-98128749 TGTCTCACATGGATGGCAGCAGG - Intergenic
1114824082 14:26055868-26055890 TGTTTCAAAGAGAAGGTAGTTGG - Intergenic
1114828798 14:26112794-26112816 TCTCTCATACATATCGTAGTTGG - Intergenic
1115273990 14:31586160-31586182 TGTCTAGCACAGATGGTTCTTGG - Intronic
1115622584 14:35154641-35154663 AGTTTCCCACAGATGGTATTTGG - Intronic
1117331810 14:54719861-54719883 TAACTAACACAGATGGGAGTAGG - Intronic
1117840850 14:59859350-59859372 TGTCTTACATGGATGGCAGTAGG - Intronic
1119157208 14:72422113-72422135 TGTCTTACATAGATGGCAGCAGG - Intronic
1119572875 14:75691644-75691666 TCTCTCACACCGATGCTACTGGG - Intronic
1121758050 14:96419688-96419710 TCTTTCACAGAGATGGTAGCAGG - Intronic
1121937348 14:98032144-98032166 TGTCTTACACGGATGGCAGCAGG - Intergenic
1125351549 15:38772543-38772565 TGTCTTACACTCATTGTAGTTGG - Intergenic
1126506721 15:49413327-49413349 GGTCTTACACAGATGGTAGCAGG - Intronic
1128133607 15:65246742-65246764 TGGCTCACACAGATCTCAGTTGG + Intronic
1131138340 15:89956429-89956451 TCTCTTACACAGGTGGTAGAAGG + Intergenic
1133518207 16:6530682-6530704 TGTCTTACATAGATGGTGGCAGG + Intronic
1134773976 16:16835933-16835955 TGTCTCACATAGCTTGCAGTGGG + Intergenic
1140327113 16:74015166-74015188 TGTCTTACACAGATGGCAGCAGG - Intergenic
1144514822 17:15910029-15910051 TGGCTCACACAGGTGGTTGAGGG + Intergenic
1145746255 17:27322188-27322210 TGTCTGATACAGCTGGTAGAAGG - Intergenic
1147912296 17:43862907-43862929 TGTCTAACACAGAGGAGAGTAGG + Exonic
1150444835 17:65220965-65220987 TGCCTCACACCAATGGTAGGTGG + Intronic
1150637182 17:66921837-66921859 TGTCTTACATAGATGGCAGCAGG - Intergenic
1153042529 18:827372-827394 TGTCTCACACTGAAGGCAGTCGG + Intergenic
1153214950 18:2810784-2810806 CGTCTTACACAGATGGCAGCAGG + Intergenic
1155581714 18:27315843-27315865 TGTCTTACATGGATGGCAGTAGG - Intergenic
1155865280 18:30957227-30957249 TGCCCCACACAGATGGTGCTTGG + Intergenic
1156083087 18:33364070-33364092 GGTCTCACTCACATGGTTGTTGG - Intronic
1156220417 18:35045274-35045296 TGTTTCATGCAGATGCTAGTTGG + Intronic
1156269941 18:35521368-35521390 TTGCTCACACATTTGGTAGTTGG - Intergenic
1156586551 18:38437583-38437605 AGTCTCACACAGATGGCTTTGGG - Intergenic
1157313780 18:46571970-46571992 TGTTTCACAGAGGTGGCAGTGGG - Intronic
1158814774 18:61082620-61082642 TTTCTGGCACAGATGGTAGCTGG - Intergenic
1159349892 18:67258890-67258912 TGTCTTAGACAGATGGCAGCAGG - Intergenic
1160515003 18:79473279-79473301 TGTCTCCCTCAGGTGGTTGTGGG - Intronic
1160638840 19:107700-107722 AGTCTCACTGAGATGGGAGTAGG - Intronic
1160859508 19:1231684-1231706 TGTCTCACACACACAGGAGTGGG + Intronic
1163293206 19:16394248-16394270 TGTCCCACACAGACTGGAGTTGG + Intronic
1163498757 19:17663111-17663133 AGTGTCACTCAGAGGGTAGTGGG - Intronic
1164895833 19:31876889-31876911 TGTTTCCAACAGATGGAAGTTGG + Intergenic
925638312 2:5964058-5964080 TGTCTCACAATCATGGTAGAAGG + Intergenic
925828797 2:7876035-7876057 GGTCCCACACAGATGGGACTCGG + Intergenic
926402706 2:12514817-12514839 AGTCTCACACTGAGTGTAGTTGG + Intergenic
927656585 2:24952709-24952731 TGTCTCACACACACGGTGATGGG - Intronic
929771204 2:44893571-44893593 AGTGTCACACAGCTGGTAGGTGG + Intergenic
930296065 2:49555604-49555626 TGTCTCACACAGATGCTGTGAGG - Intergenic
930442878 2:51431371-51431393 TGTCTTACATGGATGGTAGCAGG - Intergenic
930583103 2:53236043-53236065 TGTCTGATTCAGATGGTGGTTGG - Intergenic
933584955 2:84169854-84169876 TGTCTTACATAGATAGTAGCAGG - Intergenic
939586720 2:144014834-144014856 TGACTCATAGAAATGGTAGTGGG - Intronic
940016225 2:149108181-149108203 TGTCTTACATAGATGGCAGCAGG - Intronic
940018139 2:149128500-149128522 AGTCTCACAAGGATGGAAGTTGG + Intronic
940581854 2:155590328-155590350 TCTCTCACAGAGATGCTAATTGG + Intergenic
943180997 2:184540874-184540896 TAGCTCACACATATGGTTGTTGG - Intergenic
944804357 2:203266604-203266626 TCTGTTACACAGATGGTAATGGG + Exonic
945024125 2:205604341-205604363 TGTCTTACATAGATGGCAGCAGG + Intronic
945965592 2:216183115-216183137 TGTGTAACAAATATGGTAGTGGG - Intronic
946760709 2:222990434-222990456 TGACTTACACAGATGGCAGCAGG + Intergenic
947210538 2:227704602-227704624 TGTCTCAAACAGAGGGTAAGAGG - Intronic
948712197 2:239832213-239832235 TGTCTCACATGGATGGCAGCAGG - Intergenic
1169447950 20:5688166-5688188 TGACTGACATAGATGGTACTTGG + Intergenic
1169985336 20:11437111-11437133 TGTCTTACACGGATGGCAGCAGG + Intergenic
1173098402 20:40060584-40060606 TGTCTTACATGGATGGCAGTAGG - Intergenic
1177472017 21:21571454-21571476 TGTCTTACACGGATGGCAGCAGG - Intergenic
1179252450 21:39683553-39683575 TGTCTTACATGGATGGCAGTAGG + Intergenic
1181766503 22:25096026-25096048 TGCCTGCCGCAGATGGTAGTTGG + Intronic
1183062361 22:35344189-35344211 TCTCTCACCCAGATGGGAGGCGG + Intronic
1184967354 22:47989914-47989936 TTTCTCACTCAGAGGGTAGAAGG - Intergenic
949363178 3:3253241-3253263 TGTCTTACACGGATGGTGGTAGG + Intergenic
951242652 3:20305103-20305125 TGTCTCACATGGATGGCAGCAGG + Intergenic
952860486 3:37808371-37808393 TGTCTCCCACGGAGGCTAGTGGG + Intronic
953503905 3:43464010-43464032 TGTCTTACATAGATGGTAGTAGG - Intronic
953772159 3:45785998-45786020 TCCCTCACACACCTGGTAGTGGG - Intronic
954919204 3:54175153-54175175 TGTGTCACACACATTGTAGCTGG + Intronic
956475092 3:69610986-69611008 TGTCTTACATGGATGGTGGTGGG - Intergenic
956790881 3:72679158-72679180 TGTGGCACACATAAGGTAGTGGG + Intergenic
957066459 3:75527078-75527100 TGTCTCACATGGATGGCAGCAGG + Intergenic
958638385 3:96775280-96775302 CGTCTTACACAGATGGCAGCAGG + Intergenic
961286687 3:125810970-125810992 TGTCTCACATGGATGGCAGCAGG - Intergenic
961500003 3:127325690-127325712 TGTCTCACACATTTGTGAGTTGG + Intergenic
962272808 3:133990595-133990617 TGTCTCCAACAGATGGCAGGTGG + Intronic
963469621 3:145724037-145724059 TGTCTCACATGGATGGCAGCAGG + Intergenic
964078895 3:152726937-152726959 AGACTAACACAGATGGTATTAGG - Intergenic
964784250 3:160376835-160376857 TGTCTTACTCACATGGTTGTTGG - Intronic
965434197 3:168627060-168627082 CGTCTTACACGGATGGTGGTGGG - Intergenic
965631670 3:170739733-170739755 TGTGTCACAAAGACGATAGTGGG - Intronic
965955639 3:174365584-174365606 TGGCTAATACAGTTGGTAGTTGG + Intergenic
966867513 3:184267426-184267448 TGTCTTACACGGATGGCAGCAGG + Intronic
969223165 4:5774574-5774596 TTTCTCACACAGCAGGTACTTGG - Intronic
969802384 4:9578831-9578853 TGTCTCACATGGATGGCAGAAGG - Intergenic
970141090 4:12983022-12983044 TGTCTTACATGGATGGCAGTAGG - Intergenic
972105490 4:35480302-35480324 TGTCTCAGACAATTGGTGGTTGG + Intergenic
972301975 4:37793072-37793094 TGTCTTACATGGATGGTGGTAGG - Intergenic
972991729 4:44829055-44829077 TATCTCACACAGTTGTTATTAGG - Intergenic
974675711 4:65086156-65086178 CGTCTTACACAGATGGCAGCAGG + Intergenic
976209256 4:82651129-82651151 TGTCTCACACAGATGGTAGTTGG + Intronic
976219061 4:82741468-82741490 TCACTCACACAGCTGGTGGTTGG - Intronic
976264271 4:83175314-83175336 TGTCTCAGGCAGGTGGTGGTTGG - Intergenic
976732508 4:88278416-88278438 GGTTTGACCCAGATGGTAGTGGG - Exonic
978938938 4:114414564-114414586 TGTCTTACATAGATGGCAGCAGG - Intergenic
983244589 4:165273631-165273653 TGTCTTACACGGATGGCAGCAGG - Intronic
983437359 4:167732042-167732064 TGTCTTACATGGATGGCAGTAGG - Intergenic
984553435 4:181186469-181186491 TGTCTTACAGGGATGGTAGCAGG + Intergenic
986919570 5:12665917-12665939 GGTCTCACACAGATGGGACGCGG + Intergenic
987602209 5:20085688-20085710 TGTCTTACACAGATGCCAGCAGG + Intronic
987794589 5:22609966-22609988 TGTCTAACACAGGTGGAACTGGG - Intronic
988091222 5:26543279-26543301 TGCCTTACACAGATGGCAGCAGG + Intergenic
988117355 5:26912972-26912994 TGTCTTACACGGATGGCAGCAGG - Intronic
989458353 5:41668068-41668090 TGTCTTACATAGATGGCAGCAGG - Intergenic
991254402 5:64598519-64598541 TGTCTCACACAAACAGTAGAAGG + Intronic
991475328 5:67012359-67012381 TGTCTCACACAGATGGAAACTGG + Intronic
993442278 5:87972407-87972429 TGTCTTACACGGATGGCAGCAGG + Intergenic
994563762 5:101413448-101413470 TGTCTGACACGGATGGCAGCAGG + Intergenic
997057186 5:130458895-130458917 TGTCTTACATGGATGGCAGTAGG - Intergenic
997652087 5:135529794-135529816 TGTCTTACATGGATGGCAGTAGG - Intergenic
997652170 5:135530566-135530588 TGTCTTACATAGATGGCAGCAGG + Intergenic
998386407 5:141759601-141759623 TGTCTCACACAGCTGGTAAGTGG + Intergenic
998591027 5:143478544-143478566 CGTCTCACACAGATGGCAGCAGG - Intergenic
998603420 5:143608228-143608250 CGTCTTACACGGATGGCAGTAGG - Intergenic
999028612 5:148263938-148263960 TGTCTCACATGGATGGCAGCAGG + Intergenic
999271530 5:150299101-150299123 TGACTCACACGGCTAGTAGTTGG + Intronic
999682616 5:154074230-154074252 TGAGTCACACAGATAGAAGTGGG - Intronic
1003356185 6:5373449-5373471 TGTCCTACACATATGGTAGTTGG - Intronic
1003483818 6:6557147-6557169 TGGCTCAGGCAGATGTTAGTAGG - Intergenic
1003952302 6:11127598-11127620 TGTCTTACACGGATGGCAGCAGG + Intronic
1004437771 6:15613696-15613718 TGTCCCACAAAGATTGTAGGAGG - Intronic
1008684215 6:53906207-53906229 GGGCTCACACAGCTGGGAGTTGG + Intronic
1012840552 6:104324231-104324253 GGTCTCACACAGCTAGTAGCTGG + Intergenic
1012956702 6:105578675-105578697 TGTCTCACATGGATGGCAGCAGG + Intergenic
1015607148 6:134969871-134969893 TGTCTCACACAGATTAGAGAGGG + Intronic
1016216424 6:141608860-141608882 TGTCTTAAACGGATGGCAGTAGG - Intergenic
1016566644 6:145462602-145462624 TGACTCCCACAGATGTCAGTTGG + Intergenic
1017019384 6:150128010-150128032 TGTCTCACAGAGATGGTATGAGG - Intergenic
1017979977 6:159392882-159392904 TGTCTTACATGGATGGTAGCAGG + Intergenic
1018211533 6:161487352-161487374 TGGCTCACACAGATGGGCGAAGG - Intronic
1018425713 6:163678827-163678849 TGCCACATAAAGATGGTAGTGGG + Intergenic
1018495384 6:164342111-164342133 TGTCCCGCACAGATGGGACTCGG + Intergenic
1018847419 6:167565270-167565292 TGTCTTACATGGATGGTAGAAGG + Intergenic
1019320865 7:414666-414688 TGTCTCACACATGGGGTGGTGGG - Intergenic
1022703500 7:32782542-32782564 TGTCTTACATGGATGGTAGCAGG + Intergenic
1022907740 7:34872668-34872690 TGTCTTACATGGATGGTAGCAGG + Intronic
1023337595 7:39186579-39186601 TGTCTCACAGGGATGGTTTTGGG - Intronic
1023565052 7:41515870-41515892 TGTCTTACACGGATGGCAGCAGG - Intergenic
1023787044 7:43717913-43717935 TGTCTTACATAGATGGCAGCAGG - Intronic
1025908564 7:65809250-65809272 AGACTCACACAGATGGGATTTGG + Intergenic
1025912098 7:65837518-65837540 AGACTCACACAGATGGGATTTGG + Intergenic
1029724163 7:102391091-102391113 TGACTCACACAGATGGGACAGGG - Intronic
1029881724 7:103819400-103819422 TGTCTGAAACAGTTGGTAGTGGG + Intronic
1030157377 7:106468720-106468742 TGTCTCACATGGATGGCAGCAGG + Intergenic
1031004687 7:116457816-116457838 GGTCTCACACAGATGGGACGCGG - Intronic
1031777365 7:125919946-125919968 GGTCCCACACAGATGGGACTTGG - Intergenic
1032453330 7:132053259-132053281 TGTCTTACATGGATGGCAGTGGG - Intergenic
1033611461 7:142967180-142967202 GGTCTCACACACATGGTTCTTGG + Intergenic
1033823591 7:145162710-145162732 GGTCTCACAAACATGGTAGAAGG - Intergenic
1036252592 8:7175782-7175804 TGTCTCACATGGATGGTAACAGG + Intergenic
1036364907 8:8111680-8111702 TGTCTCACATGGATGGTAGCAGG - Intergenic
1036496373 8:9273560-9273582 TCTCTCACACAGATGTTTTTAGG + Intergenic
1037419100 8:18683037-18683059 CTGCTCACACAGATGGTGGTGGG + Intronic
1040864906 8:52038928-52038950 TGTCTCTCATGGATGGCAGTGGG - Intergenic
1042651588 8:71048056-71048078 TGTCTCCCTCACATGGAAGTTGG - Intergenic
1044087330 8:87956843-87956865 TGTCTTACACGGATGGCAGCAGG + Intergenic
1044323059 8:90827333-90827355 TGTCTCACACTGTTTGTGGTAGG + Intronic
1047339996 8:123971849-123971871 TGTCTCACACACAGAGTACTGGG - Intronic
1047347044 8:124038724-124038746 TGTCTCACACAGATCCATGTGGG - Intronic
1047505192 8:125474113-125474135 AGTACCACACAGATGGTATTAGG + Intergenic
1048699893 8:137077114-137077136 TGTCTCACATGGATGGCAGTAGG - Intergenic
1048770974 8:137894752-137894774 TGTTTCACTCAGATGGTGGCTGG + Intergenic
1050032965 9:1405642-1405664 TGTTTCACACAGATGGTGGAAGG - Intergenic
1050114806 9:2252805-2252827 TGTCTTACATGGATGGTAGCAGG - Intergenic
1050156134 9:2667897-2667919 TGTCTTACATGGATGGCAGTAGG - Intergenic
1051013793 9:12450798-12450820 TAGCTCACTCAGATGGTTGTTGG + Intergenic
1051495175 9:17713509-17713531 TTTCTAACACAGATGTTAGGTGG + Intronic
1051709878 9:19920699-19920721 TGTGTCACACACAGGCTAGTGGG - Intergenic
1053143792 9:35698464-35698486 TGCCTCACACAGATTGTTGGTGG + Exonic
1055263547 9:74469177-74469199 TGTTTCACACAAATTGTAGAGGG - Intergenic
1055557256 9:77487879-77487901 TGTCTCACAGAGTTGTTATTAGG + Intronic
1055877658 9:80962676-80962698 TGTCTTACATAGATGGCAGCAGG + Intergenic
1058607572 9:106739838-106739860 TGTTTCACACAGGTGGTTTTAGG - Intergenic
1059795173 9:117686922-117686944 TGTCTCACTGAGCTGGGAGTGGG - Intergenic
1060569348 9:124623843-124623865 TCTGTCAAACAGATGTTAGTGGG - Intronic
1186191048 X:7067948-7067970 TGTCTTACATGGATGGCAGTGGG - Intronic
1186674868 X:11805600-11805622 TGTGTTACACACATGGTATTGGG - Intergenic
1188449438 X:30294026-30294048 TGTCTTACATAGATGGCAGCAGG - Intergenic
1189955434 X:46272695-46272717 TTTCTCACATAGATTGTATTAGG - Intergenic
1191104336 X:56763321-56763343 GGTTTCACACAGATGGGGGTGGG - Intergenic
1192526421 X:71848868-71848890 TGTTTAACCCAGATGCTAGTTGG + Intergenic
1194364279 X:92995384-92995406 TGTCTCACATGGATGGCAGCAGG - Intergenic
1194857000 X:98943625-98943647 AGTCACACACAGATTTTAGTTGG - Intergenic
1195551761 X:106179701-106179723 ACTGTCACACAGATAGTAGTGGG - Intronic
1196278420 X:113795745-113795767 TGTCTTACACGGATGGCAGCAGG - Intergenic
1196326908 X:114416281-114416303 TGTCTTACACAGATGGCAGCAGG - Intergenic
1199300370 X:146206218-146206240 TGTTTCACACAGAAGGGAATGGG + Intergenic
1199302022 X:146223796-146223818 CGTCTCACATAGATGGCAGCAGG + Intergenic
1199970114 X:152853499-152853521 TGTCTCACCTAGATGTTAGAGGG + Intronic