ID: 976212279

View in Genome Browser
Species Human (GRCh38)
Location 4:82683129-82683151
Sequence GAGAGAAAACAGGAGCATGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 725
Summary {0: 1, 1: 1, 2: 4, 3: 85, 4: 634}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976212276_976212279 9 Left 976212276 4:82683097-82683119 CCGACAAGCATATGTTCAGCTTT 0: 1
1: 0
2: 1
3: 12
4: 195
Right 976212279 4:82683129-82683151 GAGAGAAAACAGGAGCATGGCGG 0: 1
1: 1
2: 4
3: 85
4: 634

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976212279 Original CRISPR GAGAGAAAACAGGAGCATGG CGG Intronic
900390080 1:2430007-2430029 GAGAAACAGCTGGAGCATGGAGG + Intronic
900904192 1:5539399-5539421 GGGAGAAAGCAGGAGTTTGGGGG + Intergenic
901784658 1:11616807-11616829 GAGAGAAAACTGGGGCACAGAGG + Intergenic
902190193 1:14757288-14757310 AAGAGAAAGCAGGAGCAGGCAGG - Intronic
902218312 1:14948708-14948730 CAGAGAAAGCAGTAGCATGGAGG + Intronic
902399852 1:16151846-16151868 GAGAGGCAACTGGAGCCTGGCGG + Intronic
903459195 1:23508997-23509019 GAAAACAGACAGGAGCATGGGGG - Exonic
904095244 1:27971869-27971891 GAGAGAAAACAGGAGCTTCTTGG - Exonic
904324747 1:29721111-29721133 GAGTGAAGTCAGGAGCTTGGGGG + Intergenic
904429061 1:30450276-30450298 GAGAAAAAGCTGGAGCATGCAGG + Intergenic
905788504 1:40776704-40776726 AAGAGAGAACAGGAACTTGGGGG - Intergenic
905992298 1:42348771-42348793 GAAAGAAGAAAGGAGCATTGAGG - Intergenic
906096505 1:43227822-43227844 GAGGGAAAACTGGAGGAAGGGGG - Intronic
906667187 1:47630315-47630337 GGGGGAAAACAGGAGCATAGTGG + Intergenic
908724154 1:67157091-67157113 GAGAGAGAGCAGAAGCAGGGTGG - Intronic
910489093 1:87748201-87748223 GAGAGAACAGTGGAGGATGGTGG + Intergenic
910855519 1:91691210-91691232 GAGAGAAAACAGAAAAAAGGGGG + Intronic
912735834 1:112148783-112148805 GGGAGAAAACAGGAAGATGTGGG + Intergenic
912745676 1:112243629-112243651 AAGAGAAAAGAAGAGCATGAAGG + Intergenic
914447388 1:147761311-147761333 GACAGAAACCAGGAGCACGTTGG - Intronic
915001443 1:152597573-152597595 GCCAGAAAACAGGGGCATGGTGG - Intronic
915785813 1:158610533-158610555 GAGAAAATACGGGAGCTTGGAGG + Intergenic
915905072 1:159871550-159871572 GGGAGAAAACAGGAGCAGACCGG + Intronic
916084966 1:161261853-161261875 GAGAGCAAACAGGATAATGAAGG - Intronic
916318014 1:163472098-163472120 GAGAGAAATAAGGAGCAAGAGGG - Intergenic
916611379 1:166395247-166395269 GGGAGAAAAGAGAGGCATGGAGG + Intergenic
917659087 1:177160248-177160270 TGGAGAAAACAGAAGAATGGGGG - Intronic
918151151 1:181799067-181799089 GAAAGAAACCAGGAACGTGGAGG + Intronic
919335903 1:196233260-196233282 GTTAGAATACAGGAGCATTGGGG - Intronic
919542405 1:198866077-198866099 GAGAGAAAACAGTAACCTGCTGG - Intergenic
919750827 1:201037057-201037079 AAGAGAAAAGAGGAGATTGGAGG + Intergenic
919908109 1:202092243-202092265 GGGACAAAACAGAAGCATTGTGG - Intergenic
920055914 1:203191567-203191589 AAGAGGAAACAGGAGTAAGGGGG - Intergenic
920299634 1:204980651-204980673 GAGAGGAGACAGGAGCAGAGGGG + Intronic
920366708 1:205451598-205451620 GAGACAAAACAGGAGTGAGGGGG + Intronic
920606356 1:207391712-207391734 GAAAGAGAGCAGGAGCAAGGGGG + Intergenic
921379921 1:214514047-214514069 GAGAGAAAAAAGGAAAATTGAGG - Intronic
921626101 1:217379514-217379536 GAGGGCAAACAGAAGCAGGGTGG + Intergenic
922101692 1:222482356-222482378 GAAAGAAGAAATGAGCATGGTGG - Intergenic
922262772 1:223957472-223957494 GAAAGAAGAAATGAGCATGGTGG - Intergenic
923238519 1:232058263-232058285 GAGAGAAATCAGGATTATGAAGG - Intergenic
923475803 1:234329958-234329980 GAGGGAAAGCAGGAGCACTGGGG - Intergenic
923892018 1:238226614-238226636 GGGAGAAAACTGAATCATGGGGG - Intergenic
924264164 1:242264336-242264358 CATAGAAAACATGTGCATGGTGG + Intronic
924344610 1:243062473-243062495 GAAAGAAGAAATGAGCATGGTGG - Intergenic
1063485769 10:6419464-6419486 GAGAGAATGGGGGAGCATGGAGG - Intergenic
1063736494 10:8761434-8761456 GAAAGAAGTGAGGAGCATGGTGG - Intergenic
1064971041 10:21067465-21067487 AAGAGAAAGCAGGAGGAGGGAGG + Intronic
1065822992 10:29543624-29543646 GCGAGAGAACAGGATCATGTAGG - Intronic
1066731721 10:38442602-38442624 GAAAGAAGAAATGAGCATGGTGG + Intergenic
1068574722 10:58672272-58672294 GAGAGAAGAAAGTAGAATGGTGG - Intronic
1068802335 10:61156141-61156163 GAGAGAGAAGAGGACCAGGGTGG + Intergenic
1068880883 10:62047730-62047752 GAGTGAAAACAGGTGCATTATGG - Intronic
1068901539 10:62274823-62274845 GATAGAAAACAGTAGGAAGGGGG + Intergenic
1069437136 10:68395015-68395037 GAGAGAAAAGAGGAGCAAGGAGG + Intronic
1069649168 10:70031083-70031105 GACAGAAAACAGGAGGAAGTAGG + Intergenic
1070109457 10:73469655-73469677 GAGACCAAACAGTAGCATGCTGG - Intronic
1070637973 10:78144550-78144572 GAGAGAAGACTGGAACATGGTGG - Intergenic
1071430910 10:85605965-85605987 GAGAGAACACTGGAGCATGGTGG + Intronic
1071572590 10:86706156-86706178 GGGTGAAAACAGGATCAGGGAGG + Intronic
1072313448 10:94179365-94179387 GAGAAATAAGAGGGGCATGGAGG + Intronic
1072504873 10:96055790-96055812 TAAAGAAAAAAGGGGCATGGGGG - Intronic
1072777284 10:98211590-98211612 GAGAGAGCACATGAACATGGAGG + Intronic
1073430910 10:103486299-103486321 GAGAGAAAAGAGGATGCTGGGGG + Intergenic
1074233151 10:111557769-111557791 GAAATAAAACAGCAGCATGGAGG - Intergenic
1074292213 10:112146541-112146563 GGCAGAAGACAGGAGCGTGGTGG - Intergenic
1074348986 10:112716565-112716587 AAGAGAGAACAGGGACATGGAGG + Intronic
1074380317 10:112973958-112973980 GCAAGGAAACAGGTGCATGGAGG + Intronic
1074492517 10:113951834-113951856 GAGTGATCACAGGAGCCTGGTGG + Intergenic
1074827713 10:117226737-117226759 GAGAGACAAGAGGTGGATGGAGG + Intergenic
1074919002 10:117988287-117988309 GAGGCAAGACAGGAGCAGGGTGG - Intergenic
1075929765 10:126285844-126285866 GAGAGAACACAGGCACCTGGGGG - Intronic
1076514424 10:131035819-131035841 GAGAGGAAACAGGAGCTTTGGGG + Intergenic
1076846334 10:133071258-133071280 GAGAGAGCACAGGAGCTGGGGGG + Intronic
1077116478 11:887344-887366 GAGAGAAAATGGGAACACGGTGG - Intronic
1077581287 11:3418848-3418870 GTGGGAAAACAGGAGCCTGGAGG + Intergenic
1077983015 11:7320872-7320894 GAGAGAAGACAGCATCAAGGGGG + Intronic
1078654528 11:13226010-13226032 GAGAAAGAAGAGGGGCATGGAGG - Intergenic
1079507312 11:21167903-21167925 GTGAGAAAAAGGGTGCATGGAGG - Intronic
1079950968 11:26803924-26803946 GTGAGAAAAAAGGAGCATGGTGG - Intergenic
1080085721 11:28279430-28279452 GAGAACAAACAGAAACATGGTGG - Intronic
1080278869 11:30533323-30533345 GACAGAATAAAGGAGCTTGGGGG + Intronic
1081222419 11:40477894-40477916 GAGAGATAACTGAATCATGGGGG + Intronic
1081322147 11:41704510-41704532 GAAAGAAAACTGAAGTATGGAGG - Intergenic
1081759938 11:45570101-45570123 GAGAGACAAGAGGAGGATTGTGG + Intergenic
1081789705 11:45774282-45774304 GGGAGTAAACAGGAGCCTAGGGG + Intergenic
1081872134 11:46388017-46388039 GAGAGCTAAGAGGAGCCTGGTGG - Intergenic
1082218855 11:49608222-49608244 GAGAGAAAACAAAAGCAATGAGG + Intergenic
1083122626 11:60530771-60530793 GGGAGGAAACTGGATCATGGGGG + Intronic
1083728536 11:64641093-64641115 GAGAGGGAATGGGAGCATGGAGG + Intronic
1084238208 11:67801687-67801709 GTGGGAAAACAGGAGCCTGGAGG + Intergenic
1084834204 11:71791147-71791169 GTAGGAAAACAGGAGCCTGGAGG - Intronic
1085290580 11:75396369-75396391 GAGAGATAACAGATGGATGGGGG + Intergenic
1085362247 11:75900370-75900392 GAGAGAAAAAAAGAGAATGAGGG - Intronic
1085516272 11:77113581-77113603 GATAGAAAACAAGAGAAAGGGGG + Intronic
1085652406 11:78280310-78280332 GAGAGAAAACAGGAGGGATGAGG + Intronic
1086761710 11:90639384-90639406 AAGAGAAAAAAGGAGAGTGGGGG + Intergenic
1086934276 11:92727808-92727830 GAGAGAAGACTGGAGCCTGCAGG - Intronic
1087511470 11:99101205-99101227 GAGAGATAACTGAATCATGGGGG - Intronic
1087831057 11:102820212-102820234 GAGGGTAAGCAGGAGCAGGGTGG - Intergenic
1088332749 11:108670319-108670341 GAGAGGGAACAGGAGTAGGGAGG + Intronic
1089128924 11:116197140-116197162 GAGAGAGAACAAGAGAATGGTGG + Intergenic
1089281885 11:117380539-117380561 GAGAGCCAGCAGGAGGATGGAGG + Intronic
1089286195 11:117409593-117409615 GAAAGAAAAGAGGTGGATGGTGG - Intronic
1090207665 11:124894884-124894906 GAGGTAAAACGGGATCATGGAGG + Intronic
1090301037 11:125639800-125639822 AAGAGAATACATGAGCATAGAGG - Intronic
1091956694 12:4649773-4649795 GAGAAGAATCAGGAGCTTGGTGG + Intronic
1092174317 12:6392610-6392632 GAGAGAATTCAGGGGCAGGGAGG - Intergenic
1092240591 12:6833824-6833846 GGGAGAAGGCAGGAGCCTGGAGG + Intronic
1092408887 12:8239317-8239339 GCGGGAAAACAGGAGCCTGGAGG + Intergenic
1092525052 12:9304771-9304793 GAAAGCAAACAGGCCCATGGAGG + Intergenic
1092542216 12:9427047-9427069 GAAAGCAAACAGGCCCATGGAGG - Intergenic
1092629031 12:10358826-10358848 GAGGGCAAACAGAAGCAGGGTGG - Intergenic
1092974329 12:13729773-13729795 GAAAGAAACCAGGAGTAGGGTGG + Intronic
1092976168 12:13746830-13746852 GAGAGAAAGCAGGAGAGTGAGGG - Intronic
1093055851 12:14554928-14554950 GAGAGAAAACACCACGATGGAGG - Intronic
1093553799 12:20447175-20447197 GAGAGATAACAGTGGCTTGGAGG + Intronic
1093868403 12:24256646-24256668 GAGAGAGAAGAGGGGCAGGGTGG + Intergenic
1094544407 12:31391162-31391184 GAGAGAAAGTAGGAGATTGGGGG - Intronic
1094798336 12:34001676-34001698 GGGAGATAACTGGATCATGGGGG - Intergenic
1094825115 12:34263986-34264008 GAGAGAAAAGAGGACCACTGGGG - Intergenic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096606034 12:52767205-52767227 GAGAGAAACCAGGAAAATTGGGG - Intergenic
1096676880 12:53230932-53230954 GAGAGAAGACAGGGGAGTGGGGG - Intronic
1096869562 12:54584853-54584875 GAGACAGAACAGGGGAATGGGGG - Intronic
1097107921 12:56636054-56636076 GAGAGGAAACAGGACTCTGGGGG - Intronic
1097148403 12:56957748-56957770 GAGAGAAATCAGGAGACTAGGGG - Exonic
1098185360 12:67890681-67890703 GAGTGGACACAGGAGGATGGTGG + Intergenic
1098482905 12:70986680-70986702 GAGAGAAAAGAGGTGAAGGGAGG - Intergenic
1098605276 12:72382025-72382047 GAAACAAAACAGGAGCAAGGGGG + Intronic
1098833891 12:75397282-75397304 AAGAGAAAACAGGACACTGGGGG - Intronic
1099107809 12:78518769-78518791 GAGGGCAAACAGAAGCAGGGTGG + Intergenic
1099851219 12:88099750-88099772 GAGGGAAAACAGGAGGCTGAGGG + Intronic
1099955691 12:89351348-89351370 GATAGAAAACAGGGTGATGGTGG + Intronic
1100136017 12:91554319-91554341 AAGAGAAAACTGGACCATGCTGG + Intergenic
1101032993 12:100678200-100678222 GAGAGCAAGCGGGAGCCTGGAGG - Intergenic
1101316242 12:103631887-103631909 GAGAGAGAACAGAAGCAATGTGG + Intronic
1101825967 12:108220194-108220216 AAGAGAAAACAGGTGCAGAGGGG - Intronic
1102096933 12:110248330-110248352 GAGAGAGAGCAGGAGCAAGAAGG + Intergenic
1102514561 12:113437679-113437701 GAGAGATAAAAGGTGGATGGTGG + Intronic
1102767095 12:115443043-115443065 GAGAGGAAAAAGGAACAGGGCGG - Intergenic
1103102018 12:118185400-118185422 AACATAAAACAAGAGCATGGTGG + Intronic
1104477083 12:129079589-129079611 TCGAGAAAGCAGGAGAATGGAGG - Intronic
1105645865 13:22316743-22316765 GAGAGCAAACTGAAGCAGGGTGG - Intergenic
1106256008 13:28022568-28022590 GAGAGAAAACAGGAGAGAAGAGG + Intronic
1106509002 13:30396949-30396971 TAGAGACAACAGCAGAATGGTGG - Intergenic
1106909716 13:34450562-34450584 GAGAGTAAACAGGCGGGTGGTGG - Intergenic
1106928878 13:34641819-34641841 AAGAGAAAGCAGGCGCAGGGTGG + Intergenic
1106945690 13:34824983-34825005 GAGAGTAGAAAGGAGAATGGTGG - Intergenic
1106947213 13:34842070-34842092 GAGAGCTAACTGGATCATGGGGG + Intergenic
1107115563 13:36742266-36742288 GATAGAAAACAAGAGAAAGGCGG - Intergenic
1107118202 13:36769728-36769750 GAAAGAGCACAGGTGCATGGAGG + Intergenic
1107289913 13:38840250-38840272 GAGAGCAAGCAGAAGCAGGGTGG - Intronic
1107938441 13:45364280-45364302 TGGAGAAAGCAGGAGCAGGGAGG - Intergenic
1109556436 13:63981995-63982017 GAGTGAATGCAGGAGCAAGGAGG + Intergenic
1109561668 13:64057520-64057542 GAGAGAAATCAGCCCCATGGGGG + Intergenic
1109744760 13:66610219-66610241 GAGAGAGAACAGGGGTAAGGGGG + Intronic
1110548875 13:76789705-76789727 GAGACAAAAGAGGAGAAAGGTGG - Intergenic
1110904442 13:80867863-80867885 GAGAAAATAAAGGAGAATGGAGG + Intergenic
1111386616 13:87536743-87536765 GAGAAAAGATAGAAGCATGGGGG + Intergenic
1111592106 13:90361828-90361850 GAGAGAAAAGAGGAGCTTTAGGG + Intergenic
1111860497 13:93698821-93698843 GAGAGAAAAAAGGAAGAAGGAGG - Intronic
1112838639 13:103548063-103548085 GACAGGAAACAGGAGGCTGGAGG - Intergenic
1112906133 13:104424930-104424952 GAGAGAAATCCTGAGCCTGGAGG - Intergenic
1113052100 13:106224333-106224355 GAAAGAAAACAGGACACTGGTGG + Intergenic
1113243110 13:108362028-108362050 GAGAGGAAACAGGTGCAGGATGG + Intergenic
1113340549 13:109420142-109420164 GAGAGCAATCAGCAGCATGATGG - Intergenic
1114267452 14:21081377-21081399 GTGAGAAAACAGGAGAGTGACGG + Intronic
1116267504 14:42712599-42712621 GAGAGATAACTGAATCATGGGGG - Intergenic
1117172312 14:53113581-53113603 GAGAGTGAGCAGAAGCATGGTGG + Intronic
1117218633 14:53578738-53578760 GAGAGAAAAGAAGAGCACAGAGG + Intergenic
1117710620 14:58525405-58525427 GAGAGCAAGCAGAAGCAGGGTGG + Intronic
1117750956 14:58923725-58923747 GAGAGCAAACAAAAGCAGGGTGG + Intergenic
1117922476 14:60739519-60739541 GAGAAAATACAGGAGCAGAGAGG + Intronic
1120224841 14:81779031-81779053 GAGGGAAGCAAGGAGCATGGTGG - Intergenic
1120442464 14:84558136-84558158 GGGAGAAAATAGAATCATGGGGG - Intergenic
1120501578 14:85303790-85303812 AAGAGAAAACAGGAGCAAACGGG - Intergenic
1121216527 14:92252815-92252837 GAGAGAAAACAGAAGAAGGAGGG + Intergenic
1121465856 14:94115175-94115197 GAGAGGAAACAGGAGCTCAGAGG - Intronic
1121787927 14:96676660-96676682 GAGAGCAAGCAGTAGCATGCAGG - Intergenic
1122114038 14:99518791-99518813 GAGGGAAGCCAGGAGCGTGGGGG + Intronic
1122241713 14:100372823-100372845 GAGAGAGCACATGAGCAAGGGGG - Intronic
1122850166 14:104523718-104523740 GGGAGAAAGCAGGAGCAGGCGGG + Intronic
1123006405 14:105325886-105325908 GAGAGTAAACAAAGGCATGGAGG - Intronic
1123811632 15:23932531-23932553 GTGAGAAAGCAGGAGCAGGAAGG + Intergenic
1124503677 15:30253170-30253192 GAGAGAAAACAGGATGCAGGAGG - Intergenic
1124739879 15:32285468-32285490 GAGAGAAAACAGGATGCAGGAGG + Intergenic
1125431532 15:39599527-39599549 GAGAGAAAGAAGGAGGAGGGAGG - Intergenic
1127438825 15:58986083-58986105 GTGAGAAAATAGGAGGATTGAGG + Intronic
1127670396 15:61189048-61189070 GAAAGAAAATAAGAGCAAGGGGG + Intronic
1128287036 15:66445818-66445840 GAGAGATTAAAGGAGCATGAAGG + Intronic
1128396281 15:67229581-67229603 GAAAGAAAAAAGGAGGAAGGAGG + Intronic
1128429046 15:67573491-67573513 GAGAGATGACTGGATCATGGGGG - Intronic
1128534036 15:68476854-68476876 TGGAGAAACCAGGAGCAAGGAGG - Intergenic
1128550694 15:68596337-68596359 AAGAAAATACAGGGGCATGGGGG + Intronic
1128612625 15:69086359-69086381 GAGAGAAACCAGGACTATAGAGG - Intergenic
1128882388 15:71255741-71255763 GAGAGCAAACTGAGGCATGGAGG - Intronic
1129272940 15:74428943-74428965 GAAAGAAAGCAGGGGGATGGAGG - Intronic
1130075348 15:80684169-80684191 GAGAGATAACTGAATCATGGGGG + Intronic
1130530203 15:84741422-84741444 GACAGCCAACAGGAGCTTGGAGG - Intergenic
1130698576 15:86156206-86156228 GTGAGAAAAAAAGGGCATGGTGG - Intronic
1130894923 15:88162511-88162533 GAAAGAAAACAGGAGCATGGAGG + Intronic
1131121743 15:89827399-89827421 GAGAGAAGTGAGGAGCAAGGGGG + Intergenic
1131590768 15:93746548-93746570 GAGAGCAAACAAAAGCAGGGTGG + Intergenic
1131728189 15:95250360-95250382 GAGAGGAACCAGGATCATGTAGG + Intergenic
1131893414 15:96999549-96999571 GAAGGAAAACAGGAGCAGAGAGG - Intergenic
1132024469 15:98393047-98393069 GAGAGGGAACAGGAGCAGGAAGG + Intergenic
1133037856 16:3044696-3044718 AAGAAAAAACATGGGCATGGTGG + Intergenic
1133107311 16:3520889-3520911 GAGAAAGAGCAGAAGCATGGGGG - Intronic
1133349854 16:5094134-5094156 GCGGGAAAACAGGAGCCTGGAGG + Intronic
1133386631 16:5375409-5375431 GGGAGGAAACAGCATCATGGAGG + Intergenic
1133486224 16:6221838-6221860 TGGAGAAAACTGGATCATGGGGG - Intronic
1134049773 16:11129425-11129447 GACAGAAAACAGAAGCAAAGAGG - Intronic
1134864221 16:17590465-17590487 GAGAGAAAACAGAAGCACCAAGG + Intergenic
1135144735 16:19951311-19951333 GAGAGAAGCCAGGAACCTGGAGG - Intergenic
1136074799 16:27809657-27809679 GAGAGAAAAGAGAGGGATGGAGG - Intronic
1136173553 16:28502707-28502729 GACAGATCACAGCAGCATGGAGG - Intronic
1136225484 16:28857633-28857655 GAGAGGGCACAGGAGCTTGGTGG - Intronic
1136287062 16:29250571-29250593 GGGAGAAAACTGAACCATGGGGG + Intergenic
1136591553 16:31220868-31220890 GAGAGAGAAAAAGAGAATGGTGG - Intronic
1140684748 16:77422609-77422631 GAGAGAAAAAAGGAGGAAGAAGG + Intronic
1141319764 16:82996439-82996461 GAGATAAAGCAGGACCATGCTGG - Intronic
1141341815 16:83210461-83210483 AAGAGAAATCAGAAACATGGAGG + Intronic
1142092666 16:88223203-88223225 GGGAGAAAACTGAACCATGGGGG + Intergenic
1142720048 17:1769994-1770016 GAGAGGAGACAGGAGCACGTTGG - Exonic
1142961560 17:3555105-3555127 GAGAGAGGACAGGGGCATGGTGG - Intronic
1142961588 17:3555207-3555229 GAGAGAGGACAGGGGCATGGTGG - Intronic
1143091264 17:4450253-4450275 GAGAGAAAAGAGGAGGAAGGAGG - Intronic
1143142443 17:4748795-4748817 GAGAGAAAAGATGAGGAGGGAGG - Intergenic
1143595271 17:7910146-7910168 GAAAGAAAAAGGGAGCATGGAGG - Intronic
1144023879 17:11260778-11260800 GAGAGAAAACAGGTGGAGAGAGG - Intronic
1146053700 17:29570789-29570811 GAGAATAAACAGGAGCAAAGGGG - Intronic
1146629956 17:34462734-34462756 AAGAGCAAACAGGATGATGGGGG + Intergenic
1148440805 17:47710833-47710855 AGCAGAAACCAGGAGCATGGGGG - Exonic
1148866529 17:50631619-50631641 GAGAGAAGAAAGCAGAATGGGGG - Intergenic
1149207913 17:54269705-54269727 GAGAGAAAAAATGAGAATGTTGG - Intergenic
1149549668 17:57531005-57531027 GAGAGAAAGGAGGGGCATGCAGG + Intronic
1150008041 17:61481708-61481730 TGGAGAAAACAGGAGGAGGGAGG + Intronic
1150502032 17:65660286-65660308 GAGAGAAAAGAGAAGGAGGGAGG - Intronic
1151002334 17:70392174-70392196 AAGAGAAAATTGGAGCATAGAGG - Intergenic
1151018317 17:70583198-70583220 GAGAGAAGACAGGAGGAATGAGG - Intergenic
1151355187 17:73553962-73553984 AGGAGAGGACAGGAGCATGGAGG + Intronic
1151454554 17:74218195-74218217 GAGGGAAAAGAGGAGCAGGTAGG - Intronic
1203171336 17_GL000205v2_random:149785-149807 CAGAGGAAAAAGGAGCATGGAGG - Intergenic
1153519095 18:5935167-5935189 GAGAGAAAAATGGAGCATTTGGG - Intergenic
1154192058 18:12238090-12238112 GAGACAAAATACAAGCATGGTGG + Intergenic
1156127535 18:33924997-33925019 GAAAGAAAACAGGAGCAACAAGG + Intronic
1156647222 18:39179710-39179732 GGGAGAAAATACGAGCATTGAGG + Intergenic
1156950849 18:42895910-42895932 GATAGAAACCAGGAAGATGGGGG + Intronic
1157300656 18:46476750-46476772 GAGAGAAAGCAGGGTCATTGAGG - Intergenic
1157547384 18:48555924-48555946 GAGAGAAACCCTGAGCATGCTGG + Intronic
1157561291 18:48648248-48648270 CAAAGAAAAAGGGAGCATGGGGG + Intronic
1157745600 18:50132611-50132633 CAGAGAAGAGGGGAGCATGGTGG - Intronic
1158644536 18:59232803-59232825 CAGGGAAAGCAGGAGCCTGGTGG + Intergenic
1159072115 18:63636862-63636884 GAGAGAAAGAAAGAGCCTGGGGG - Intergenic
1159386052 18:67726322-67726344 GAGAGCAAATAGAAGCAGGGTGG - Intergenic
1159540155 18:69764523-69764545 GAGAGAGAATTGGAGCATGAAGG - Intronic
1159765087 18:72479770-72479792 GAGAGATAACTGAATCATGGGGG + Intergenic
1159777002 18:72614031-72614053 CAGAGAAAACATGATCTTGGAGG - Intronic
1160130259 18:76218927-76218949 GAGAGGATACTGGAGCATGGGGG + Intergenic
1160446085 18:78927856-78927878 GAGAGTATACAGAAGCCTGGGGG - Intergenic
1160669862 19:356338-356360 GTGAAAAAACAGGAGCAAGTTGG + Intergenic
1161227805 19:3155289-3155311 GAGAGAGAACAGGAAGGTGGGGG + Intronic
1161498395 19:4599439-4599461 GAGAGAAAACAGGAGAGTTGGGG - Intergenic
1162146006 19:8612322-8612344 GGGAGCAAACAGGAGGGTGGGGG - Intergenic
1162207873 19:9069682-9069704 AAAAGAAAAGAGGAGCCTGGTGG - Intergenic
1163126170 19:15245384-15245406 GAGAAAAAAAAGGAGCAGGCTGG + Intronic
1163292950 19:16392560-16392582 GACGGAAAACAGGATAATGGTGG + Intronic
1164486545 19:28660902-28660924 GGGAGAAAACTGAATCATGGGGG + Intergenic
1165253676 19:34559599-34559621 GACAGAAAAGATGAGCAAGGAGG + Intergenic
1166024553 19:40069301-40069323 GAGAGAAAACAAGAGGGTGAGGG + Intronic
1166573684 19:43816781-43816803 GAGAGATAACTGAATCATGGGGG + Intronic
1166672455 19:44719057-44719079 GAGACAGAAGAGGAGCATGGAGG + Intergenic
1166750841 19:45163379-45163401 GTGAGTAACCAGGAGCATGAGGG + Intronic
1167049107 19:47067874-47067896 GAAAGAACAGAGGAGCAGGGAGG + Intronic
1167680131 19:50914632-50914654 GAGAGAAGACAGGAGGAAAGTGG - Intergenic
925522459 2:4762058-4762080 GAGTGCAAACCTGAGCATGGAGG + Intergenic
925627946 2:5860864-5860886 GAGGGCAAGCAGGAGCAGGGTGG - Intergenic
925895401 2:8467759-8467781 GACTGAAAACAGAAGCATGGTGG - Intergenic
925945925 2:8863603-8863625 GAGAGAAAGCAGGAACAGCGAGG - Intronic
925996146 2:9294875-9294897 GGGAGTAAGCAGGACCATGGAGG + Intronic
926158252 2:10469887-10469909 GAAAGAACACAGGAGCCTGCAGG + Intergenic
926195512 2:10761417-10761439 GAGGGTAACCAGGAGGATGGCGG - Intronic
927022097 2:19028102-19028124 AAGAAACAACAGCAGCATGGTGG + Intergenic
927116218 2:19904687-19904709 GAGAAAAAACTGAATCATGGGGG - Intergenic
927209032 2:20627445-20627467 GAGAGAGAACAGGCGCGAGGAGG + Intronic
927652128 2:24919524-24919546 GAAAGAAATCAGGACCATCGTGG + Exonic
928161002 2:28924481-28924503 GAGAGAAAACAGGTACAAGTTGG + Intronic
928771582 2:34708214-34708236 GAGAGGTAATAGGATCATGGGGG + Intergenic
928922303 2:36538442-36538464 GCGAGAAAACATGAGAATCGAGG - Intronic
929837135 2:45413526-45413548 GAGAGAAAAGAGGAAAATGTAGG + Intronic
930654710 2:53996344-53996366 GAGATAAAAAAGGAGGATGGAGG + Intronic
930860422 2:56065844-56065866 GAGGGAAAACAGAAGCAGAGTGG - Intergenic
931752888 2:65346549-65346571 GAGACAAGACAGTAGAATGGTGG - Intronic
932155984 2:69418096-69418118 GAAAGAAAACTGAAGAATGGGGG + Intronic
932562747 2:72887417-72887439 GGCGGAGAACAGGAGCATGGAGG + Exonic
932711717 2:74070409-74070431 GAGAGATAACTGAATCATGGAGG - Intronic
934298954 2:91765604-91765626 GAAAGAAAGCAGGGGCAAGGTGG - Intergenic
934904199 2:98184802-98184824 ACCAGAAAACAGGAGCAAGGAGG - Intronic
935347390 2:102121247-102121269 GAGAGAAACCAGGGGGTTGGGGG - Intronic
935668871 2:105538396-105538418 GAGCAAAGACAGCAGCATGGTGG - Intergenic
937102464 2:119282445-119282467 GAAAGAGAACAGGAGCAAGCTGG - Intergenic
937907488 2:127059298-127059320 GAGAGAGAGCAGGAGGGTGGGGG + Intronic
938846618 2:135216355-135216377 GAGAGATTACAGGTGTATGGAGG + Intronic
939061033 2:137421507-137421529 AAGAGACAAGAGGGGCATGGGGG + Intronic
940136807 2:150446377-150446399 GAGAGAAAACTGAAGCCTGTGGG - Intergenic
940274560 2:151925674-151925696 GATAGAAAAGAGGAGCAGGGAGG + Intronic
941225181 2:162839000-162839022 GAGAGAGAAAAGGAGGCTGGGGG + Intergenic
942115625 2:172726464-172726486 GACAGGAAACAGGAGATTGGAGG - Intergenic
942300436 2:174556170-174556192 GACAGAAAACAGGAAAAGGGTGG + Intergenic
942725177 2:178998472-178998494 GAAAAAAAACTGAAGCATGGAGG - Intronic
942805463 2:179927125-179927147 GAAGGAAGACAGGAGAATGGAGG - Intergenic
942953408 2:181747940-181747962 GGGAGGTAACAGGATCATGGGGG - Intergenic
942961482 2:181834577-181834599 GAGAGAGAAAGAGAGCATGGGGG + Intergenic
943015187 2:182501842-182501864 GAGGGAAAACTGGAGCTTGAGGG - Intronic
943620377 2:190141598-190141620 TCAAGAAAACAGCAGCATGGGGG + Intronic
943821113 2:192322172-192322194 AAGAGAAAATAGAAGCATGAAGG - Intergenic
944256944 2:197632666-197632688 GTGAGAAAAGAGGAGGGTGGTGG + Intronic
944761399 2:202818584-202818606 GAGAGATAACTGAATCATGGGGG + Intronic
945146496 2:206743742-206743764 GAGAGAAAATATGAGAATGTGGG - Intronic
945482287 2:210357986-210358008 GAGGGCAAACAGAAGCAGGGTGG - Intergenic
945714002 2:213336045-213336067 GAGAGCAAAGAAGAGCATCGAGG + Intronic
946024490 2:216663912-216663934 GAGAGAGGAGAAGAGCATGGAGG - Intronic
946123896 2:217542643-217542665 GAGAGATGACTGGATCATGGGGG - Intronic
946736496 2:222759192-222759214 TCGTGAGAACAGGAGCATGGAGG + Intergenic
947752082 2:232538449-232538471 GGGAGAAAACAGGAGGGTGGAGG + Intergenic
948038459 2:234879233-234879255 GAGAGGAGACAGGAGAAGGGTGG + Intergenic
948141734 2:235678321-235678343 AAGAGGAGACTGGAGCATGGAGG + Intronic
1169620293 20:7499027-7499049 GAGAGAACACAGGTTGATGGTGG - Intergenic
1169768569 20:9176163-9176185 TAGAGGAAACAATAGCATGGAGG - Intronic
1170399248 20:15961892-15961914 GAAAGAAATCAGAAGGATGGAGG + Intronic
1170706297 20:18747413-18747435 GAGAAAACACAGAAACATGGCGG - Intronic
1171293465 20:23995751-23995773 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1172452586 20:35038028-35038050 CAGAGAAAAAAGCAGAATGGTGG + Intronic
1172782913 20:37447783-37447805 CAGAGGAAACAGGAGAAGGGTGG - Intergenic
1173072918 20:39786725-39786747 GAGAGATAACTGAATCATGGGGG - Intergenic
1173131233 20:40395616-40395638 GAGAGAAAACAGAAGATTGGAGG + Intergenic
1173353000 20:42262126-42262148 GAAAGAAAACATGTTCATGGTGG - Intronic
1174301318 20:49584606-49584628 GAGAGAAAACAGGCTCAGAGAGG - Intergenic
1174791737 20:53484671-53484693 GAGATAAAGGACGAGCATGGTGG - Intronic
1175286731 20:57841611-57841633 GAGAAAGCACAGGAGCGTGGGGG - Intergenic
1175581341 20:60102159-60102181 GTGAGAAAGCAGAAGCCTGGGGG + Intergenic
1175861349 20:62151917-62151939 GAGGGAAAAGAGGAGAACGGGGG - Intronic
1176268642 20:64223877-64223899 AAGAGAAGGCATGAGCATGGGGG - Intronic
1176327320 21:5511613-5511635 CAGAGGAAAAAGGAGCATGGAGG - Intergenic
1176330389 21:5544618-5544640 CAGAGGAAAAAGGAGCACGGAGG + Intergenic
1176397368 21:6276333-6276355 CAGAGGAAAAAGGAGCACGGAGG - Intergenic
1176400437 21:6309338-6309360 CAGAGGAAAAAGGAGCATGGAGG + Intergenic
1176436720 21:6679766-6679788 CAGAGGAAAAAGGAGCATGGAGG - Intergenic
1176439789 21:6712771-6712793 CAGAGGAAAAAGGAGCACGGAGG + Intergenic
1176460982 21:7006836-7006858 CAGAGGAAAAAGGAGCATGGAGG - Intergenic
1176464051 21:7039840-7039862 CAGAGGAAAAAGGAGCACGGAGG + Intergenic
1176484543 21:7388614-7388636 CAGAGGAAAAAGGAGCATGGAGG - Intergenic
1176487612 21:7421619-7421641 CAGAGGAAAAAGGAGCACGGAGG + Intergenic
1176723315 21:10410784-10410806 GAGAGAAATCAAGAGCAAGAAGG - Intergenic
1177040110 21:16097707-16097729 GAGAGAAAACAGAGGCAGAGAGG - Intergenic
1177332977 21:19684719-19684741 GAGAGAAAGGAAGAGCAGGGTGG - Intergenic
1177742296 21:25168640-25168662 GAGAGATAACTGAATCATGGGGG + Intergenic
1178024682 21:28452627-28452649 GTGAGAAAAAAGGAGCAGAGAGG + Intergenic
1178375952 21:32067658-32067680 GAGAGAAATCAGGATCAGGGAGG + Intergenic
1178675652 21:34629451-34629473 AATAAAAAACAGGTGCATGGTGG - Intergenic
1178832891 21:36071128-36071150 GAGAGGAAGCAGGAGCCTGCAGG - Intronic
1179193446 21:39142942-39142964 GGGAGATAACTGGATCATGGGGG + Intergenic
1179409591 21:41152443-41152465 TAGAGAAAACTGAATCATGGGGG - Intergenic
1179614789 21:42575415-42575437 GAGAGAATAAAGGAGCAAAGAGG + Intronic
1179828346 21:43981089-43981111 GAGGGGAGACAGGAGAATGGTGG - Exonic
1180304473 22:11063521-11063543 GAGAGAAATCAAGAGCAAGAAGG - Intergenic
1180824521 22:18853467-18853489 CAAAGAAAACAGAAGCATGGAGG - Intronic
1181124943 22:20696622-20696644 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1181188214 22:21121081-21121103 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1181210982 22:21289412-21289434 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1181398518 22:22637476-22637498 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1181650897 22:24258584-24258606 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1181706484 22:24652155-24652177 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1181862622 22:25830647-25830669 GAGAGCAAACAGAAGCGTGCAGG + Intronic
1182118113 22:27769400-27769422 GGGAGAGAACAGGAGGCTGGGGG - Intronic
1182204262 22:28607881-28607903 GAGTGAAAGCAGAAGCAGGGAGG - Intronic
1182640703 22:31764742-31764764 GAGAGAAAAAGGGAGAAGGGAGG - Intronic
1182710479 22:32319654-32319676 GAGAAGAGACAGGAGCATGCTGG - Intergenic
1182928525 22:34150829-34150851 GAGAGGAAACAGTTTCATGGAGG - Intergenic
1183303673 22:37070743-37070765 GACAGAGAACAGGAGAATGATGG + Intronic
1184427805 22:44423409-44423431 GACAAAAAACAAGAACATGGAGG - Intergenic
1184671969 22:46017847-46017869 GAGAAAAAAGAAGAGAATGGCGG - Intergenic
1184854138 22:47137360-47137382 GAGTGGACACTGGAGCATGGTGG + Intronic
1185051980 22:48558892-48558914 GTGAGAGAATAGGAGCATGGCGG + Intronic
1185153701 22:49180605-49180627 GTGGGGAAACAGGAGCAGGGAGG - Intergenic
1203215964 22_KI270731v1_random:6018-6040 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1203274659 22_KI270734v1_random:79372-79394 CAAAGAAAACAGAAGCATGGAGG - Intergenic
949229375 3:1732439-1732461 AAGGGAAAACAGGAAGATGGAGG - Intergenic
950475993 3:13215154-13215176 TACACAAGACAGGAGCATGGAGG + Intergenic
950748257 3:15108061-15108083 AAGAGCAAACAGGTGCATGAAGG - Intergenic
951147962 3:19252165-19252187 GAGAGAAAAAAGATGCATGTTGG - Intronic
951251342 3:20397313-20397335 GACAGAAAGCAGGAGTATGAGGG + Intergenic
952268983 3:31814088-31814110 GAGAGAACCCAGGGGCAGGGTGG + Intronic
952548224 3:34446118-34446140 GGGAGATAACTGAAGCATGGGGG + Intergenic
953536868 3:43783279-43783301 GAGAGAAAAGAGAGGTATGGGGG - Intergenic
953717738 3:45330351-45330373 GAGGGAGAACTGGAGCAAGGAGG - Intergenic
953911449 3:46895249-46895271 GTGAGAAGACAAGAGCAAGGTGG - Intronic
954437108 3:50502275-50502297 GACAGATAACAGAAGCAAGGTGG + Intronic
955015842 3:55067992-55068014 GAGAGAGAAGAGGAGAATAGAGG - Intronic
955454051 3:59100804-59100826 GAGAGCAATCAGAAGCAGGGTGG - Intergenic
955736625 3:62045588-62045610 TACAGAAAACAGCAGCATTGAGG - Intronic
955810695 3:62785322-62785344 GAGATGAAACATGATCATGGTGG - Intronic
955952353 3:64255197-64255219 GAGAGTAAACTTGTGCATGGAGG - Intronic
956148111 3:66212669-66212691 TAGAGATAAAAGTAGCATGGTGG - Intronic
956392700 3:68790742-68790764 GGGAGAACACAGGAGCAGTGAGG + Intronic
956631630 3:71322566-71322588 GACAGAAAACAGGAGCCAGGTGG + Intronic
956741584 3:72280005-72280027 GAAAGAAGAAAGGAGCAGGGAGG + Intergenic
957054156 3:75431484-75431506 GTGGGAAATCAGGAGCCTGGAGG + Intergenic
957115567 3:76019973-76019995 CAGAGAAAACCGAAGCATGTGGG - Intronic
957508146 3:81152843-81152865 GAGAGAAGAAAAGAGCATGCAGG + Intergenic
957993338 3:87654169-87654191 GAGGGCAAGCAGAAGCATGGTGG - Intergenic
958536862 3:95414986-95415008 GAAAGAAAACAGAAGGAAGGAGG + Intergenic
959237235 3:103740448-103740470 GGGAGACAACTGGATCATGGGGG - Intergenic
960345133 3:116521476-116521498 GATAGAACACAAGGGCATGGTGG + Intronic
960490642 3:118313392-118313414 GAGAGAGAACAGAAACTTGGGGG + Intergenic
960718556 3:120602859-120602881 AGGACAAAACAGGAGCATGAAGG + Intergenic
961300683 3:125920229-125920251 GTGGGAAAACAGGAGCCTGGAGG - Intergenic
961314687 3:126026486-126026508 GACAGAAATCAGAAGCATGAAGG + Intronic
961887817 3:130107859-130107881 GTGGGAAAACAGGAGCCTGGAGG + Intronic
962522754 3:136212386-136212408 AAGAGAAAACAGGACAAGGGCGG + Intergenic
962982256 3:140501151-140501173 GAAAGAGAACAAGAGCAAGGTGG - Intronic
962991475 3:140581203-140581225 GAGAGCAAACAGGAGCACTAGGG - Intergenic
963401818 3:144807281-144807303 GAGAGCGAACAGAAGCAGGGTGG - Intergenic
963960845 3:151306916-151306938 GAGGGAAAACTGGAGAGTGGAGG - Intronic
964416694 3:156455199-156455221 GAGAGAAAGCAGGAAAATCGAGG - Intronic
965117368 3:164508486-164508508 GAGAGAAAACAGAAGAAAGAAGG - Intergenic
965622031 3:170651444-170651466 GAGAGCAAGCAGAAGCAGGGCGG - Intronic
966026881 3:175294979-175295001 ATGAGAAAACAGAAGCATAGAGG - Intronic
966291108 3:178360956-178360978 GAGGGCAAGCAGAAGCATGGTGG + Intergenic
966647431 3:182262287-182262309 GAGAGAATATAGCTGCATGGAGG - Intergenic
966673301 3:182554690-182554712 GAAATAAAAAAGGGGCATGGAGG - Intergenic
966989037 3:185210064-185210086 AGGAGAGAACAAGAGCATGGAGG + Intronic
967729954 3:192898015-192898037 GAGAGACCACATGGGCATGGAGG + Intronic
968614907 4:1573392-1573414 GAGAGAAACCAGGAAGAGGGAGG - Intergenic
968996954 4:3951791-3951813 GTGGGAAAACAGGAGTCTGGAGG + Intergenic
969525310 4:7701233-7701255 GAGAGAAAAAAGGAGAGAGGAGG + Intronic
969683740 4:8657388-8657410 GAGAGAACGCAGGAGCACGGGGG + Intergenic
969716534 4:8870842-8870864 GAAAGAAAATGGGAGGATGGAGG - Intronic
969748915 4:9095518-9095540 GGGAGAAGAAAGGAGAATGGAGG - Intergenic
969817010 4:9694464-9694486 GTGGGAAAACAAGAGCCTGGAGG - Intergenic
969932291 4:10642366-10642388 GAGAGAAAACAGGCACAGAGAGG + Intronic
969994874 4:11301798-11301820 AAGAGGAAACAGGAGCATCAGGG - Intergenic
971384297 4:26128776-26128798 GAGAGATAATAGAATCATGGGGG + Intergenic
971566136 4:28143969-28143991 GAGAGAGAGCAGAAGCCTGGGGG - Intergenic
972063564 4:34910942-34910964 GAGAGAAAAATGAATCATGGGGG + Intergenic
972065005 4:34931123-34931145 TAGAGAAAAGAGTAGAATGGTGG + Intergenic
973634778 4:52851900-52851922 AAGAGAAAACAGGAGTTTGGAGG - Intergenic
974142794 4:57909009-57909031 GGGAGATAACTGGAACATGGGGG + Intergenic
974202077 4:58655530-58655552 CATAGAAAACAAGAGGATGGAGG - Intergenic
974861030 4:67521896-67521918 GACAGAAAAAAGTAGAATGGTGG + Intronic
975213047 4:71722968-71722990 GAGAGAGAGCAGAAGCAGGGTGG - Intergenic
975493849 4:75016563-75016585 CAGAGAATACAAGAGCAGGGAGG - Intronic
975502407 4:75101027-75101049 GAGAGAAAGGTGGAGCAAGGTGG - Intergenic
975507897 4:75159664-75159686 GAGAGAGAAGAGGAGAGTGGGGG + Intergenic
976212279 4:82683129-82683151 GAGAGAAAACAGGAGCATGGCGG + Intronic
976306137 4:83561129-83561151 TAGAGAAAACAGCACAATGGGGG + Intronic
976572987 4:86635006-86635028 GAGACAGAACTGGAGAATGGGGG - Intronic
976752301 4:88461765-88461787 GAGAGAAAACAGTAGCGCTGGGG + Intronic
977374565 4:96185210-96185232 GAGAGAAAGAAGGAGGATAGGGG - Intergenic
977578507 4:98699890-98699912 GAGAGATAACAGCAGCATTTTGG - Intergenic
977895726 4:102362800-102362822 GAAGGAAAACAGAAGCAAGGTGG + Intronic
978628770 4:110718818-110718840 GAAGGAAAAGAGGAGCAAGGAGG - Intergenic
978816862 4:112916364-112916386 GATAGAAAATAGGAGAATGTGGG + Intronic
979258106 4:118625226-118625248 GAAAGAAGAAATGAGCATGGTGG + Intergenic
979330240 4:119415342-119415364 GAAAGAAGAAATGAGCATGGTGG - Intergenic
979417372 4:120460483-120460505 GAGAGCAAGCAGAAGCAAGGTGG + Intergenic
979421310 4:120508953-120508975 GAGGGAAAGCAGAAGCAGGGTGG + Intergenic
979770607 4:124520617-124520639 GACAGAAAACATGAGGATGATGG - Intergenic
980042362 4:127953910-127953932 GAGAGAAAACAGGATGATTGGGG + Intronic
982060456 4:151599441-151599463 GAGAGAAAATAGGAGCAAGATGG + Intronic
982217451 4:153094736-153094758 GAGAGAAACCAAAAGCATAGTGG - Intergenic
982220549 4:153121545-153121567 GAATGAAAACAGCAGAATGGAGG + Intergenic
982875762 4:160647227-160647249 GAAAGAAAATGGGAGCAGGGCGG + Intergenic
983438526 4:167749872-167749894 GGGAGAAAAAAGGAGGATGCAGG + Intergenic
983694552 4:170511931-170511953 GAGAGAAAACAGAACTTTGGTGG + Intergenic
983738585 4:171095937-171095959 GAGAGACTTCAGCAGCATGGTGG + Intergenic
983885196 4:172973487-172973509 GAGAGAAAAGAGGAGATAGGAGG + Intronic
984600700 4:181723073-181723095 GCCAGAAAACAGGAACATGGAGG + Intergenic
985243025 4:187950950-187950972 GAGAGGAGACTGGATCATGGGGG - Intergenic
987249954 5:16089871-16089893 GTGAGAAAACAGAAGTATGGAGG + Intronic
987252138 5:16110891-16110913 GAGAGAGAACTGAATCATGGGGG + Intronic
987319219 5:16752086-16752108 GAGAGAAAACAGAAACACTGGGG + Intronic
987512216 5:18855196-18855218 GAGAGAAAATTGAATCATGGGGG + Intergenic
987970566 5:24938881-24938903 GAGAGAGAACAGGGGCAGAGGGG - Intergenic
988455950 5:31387421-31387443 CGGAGAAAACAGGAGGATGGAGG + Intergenic
988627423 5:32892511-32892533 ATGAGATAACAGGAGCATAGAGG + Intergenic
989502136 5:42179873-42179895 GAGAGGAAAGAGGGGCATGGAGG + Intergenic
989825260 5:45847646-45847668 GAGGGAGAACAGAAGCAGGGTGG + Intergenic
990516059 5:56531842-56531864 GACAGAAAGATGGAGCATGGTGG - Intronic
991390422 5:66137227-66137249 GAGAGATAACTGGATCATGGAGG - Intergenic
991524045 5:67536285-67536307 AAGTGAAAACAGGACCATGTGGG + Intergenic
991620050 5:68535352-68535374 GAGAGGAAACAGGCGCCTCGGGG - Intergenic
992543016 5:77783039-77783061 GACAGGAAACAGGAGAATAGGGG + Intronic
992741255 5:79775519-79775541 AAGAGAAAACAGGAGAGAGGGGG + Intronic
993274809 5:85843718-85843740 GAGAGAGTACAGGAGCCAGGGGG + Intergenic
994156517 5:96509577-96509599 GAAATATAACATGAGCATGGAGG + Intergenic
994848468 5:105021535-105021557 GAGAGAAAACAGGAGGTTTATGG - Intergenic
995295634 5:110517906-110517928 GAGACAAAAAAGGAGCAGGTGGG - Intronic
995301833 5:110594151-110594173 GAGGGCAAGCAGAAGCATGGTGG + Intronic
995366873 5:111371913-111371935 TAGAGAAAACAGCAGAATTGAGG + Intronic
995508950 5:112888909-112888931 GAGAGATAACTGAATCATGGGGG + Intronic
995533529 5:113113783-113113805 GAGACAAAACAGCAGGAGGGAGG + Intronic
995760432 5:115556196-115556218 GATAGAAAACAAGACCAAGGTGG - Intergenic
996592189 5:125160540-125160562 GAGAGTGAACAGAAGCAGGGTGG + Intergenic
997184051 5:131863755-131863777 GAGAGATAACTGAATCATGGGGG + Intronic
997217924 5:132129718-132129740 GAGAGCAAGCAGAAGCAGGGTGG - Intergenic
997445864 5:133939732-133939754 GAGAGGTAACAGGATCATGGGGG + Intergenic
998376547 5:141694714-141694736 GAAAGGACACAGGTGCATGGAGG + Intergenic
1000358449 5:160423669-160423691 GAGATAAAGCAGGAACATGCCGG + Intronic
1001093268 5:168757101-168757123 GAAACAAAACAAGTGCATGGAGG + Intronic
1001621918 5:173093944-173093966 GAGAGTAAAAAGTAGAATGGAGG - Intronic
1002723284 5:181278849-181278871 GAGAGAAATCAAGAGCAAGAAGG - Intergenic
1003000802 6:2330981-2331003 AAAAGAAAACAGAGGCATGGTGG - Intergenic
1004042450 6:11993889-11993911 GGGAGAAAACAGAAGCAGGAGGG + Intergenic
1004657628 6:17679656-17679678 GAGAGAGAACAGGAGGTGGGAGG + Intronic
1005049677 6:21673309-21673331 GAGAGGAAAGAGGAATATGGCGG + Intergenic
1005436845 6:25821228-25821250 GAGAGAAAAAAGAAGAATGGAGG - Intronic
1006341815 6:33451598-33451620 GAAACAAAATAGGAGGATGGTGG + Intronic
1006420728 6:33932192-33932214 GATAGAAGACAGAAGCCTGGTGG + Intergenic
1006916996 6:37601218-37601240 GAGAGATGACTGGATCATGGGGG - Intergenic
1007288999 6:40770123-40770145 GAGAGATTACAGCAGCCTGGGGG - Intergenic
1007393999 6:41566928-41566950 GAGAGACAGCAGGGCCATGGAGG - Intronic
1008265886 6:49425790-49425812 CAGAGAAAAAAGTAGAATGGTGG - Intergenic
1008383079 6:50855695-50855717 TAGAGAAAACTGAATCATGGGGG + Intergenic
1009506766 6:64493088-64493110 GAGAAATAACTGGAGCATTGAGG + Intronic
1009979292 6:70708107-70708129 GAGAGGAAACAGGAAGAGGGAGG - Intronic
1010060512 6:71616979-71617001 GGGAGATAACTGGATCATGGGGG + Intergenic
1010616335 6:78016621-78016643 GAGAGAAAACAAGAGAATCAGGG - Intergenic
1011020784 6:82809787-82809809 GAGGGCAAACAGAAGCAGGGTGG - Intergenic
1011261242 6:85471995-85472017 GAGAGAAAAAAAGAGAGTGGTGG - Intronic
1011496022 6:87937274-87937296 GTGAGACAACAGGAGCACTGCGG + Intergenic
1012311685 6:97733200-97733222 GAGAGAAAAAAGTAGAATGAAGG + Intergenic
1012604883 6:101145490-101145512 GGAAAAAAACAGGAGGATGGGGG - Intergenic
1012670085 6:102033373-102033395 GAGAGGAAGCAAGAGCATGCTGG - Intronic
1012794423 6:103741347-103741369 GAGAGAAAAGAAGAGAAGGGAGG + Intergenic
1013456462 6:110334094-110334116 GAGAGAAAACAGAGGAAAGGGGG + Intronic
1013479777 6:110543737-110543759 TGGAGGAAGCAGGAGCATGGAGG + Intergenic
1013604551 6:111735636-111735658 GGGAGAAAAGAGAAGCATGGGGG + Intronic
1014177111 6:118342838-118342860 GAGGGCAAGCAGAAGCATGGTGG - Intergenic
1015195607 6:130521970-130521992 GAGAGAAAATTGAATCATGGGGG - Intergenic
1015209728 6:130683408-130683430 GGGAGAAAACAGAATCCTGGGGG + Intergenic
1016264199 6:142212857-142212879 GAGAGGTAACTGGATCATGGGGG - Intronic
1016359922 6:143256333-143256355 GAGAGAAAACAAGAGGTTGGAGG - Intronic
1017600594 6:156076617-156076639 GAGAGAAAAGACAAGCATGCAGG + Intergenic
1017764328 6:157594250-157594272 TAGAGAAAACATGAGCTTTGTGG - Intronic
1018003857 6:159602571-159602593 GAGACTAAACAAGAGCAGGGAGG + Intergenic
1018143736 6:160864110-160864132 GAGAGAACTCTGGAGCTTGGGGG - Intergenic
1018527378 6:164728176-164728198 AAAAGAAAACAGGAACATGTGGG + Intergenic
1018573608 6:165235576-165235598 GAGAGATAACTGAATCATGGGGG + Intergenic
1018618456 6:165709157-165709179 GGGAGAGTGCAGGAGCATGGAGG - Intronic
1018618574 6:165709590-165709612 GAGGGAGCACAGCAGCATGGAGG - Intronic
1019689946 7:2404670-2404692 GAGAGAAAACAGGGGTAATGAGG + Intronic
1019964167 7:4485146-4485168 GGGAGGAAGCAGGACCATGGAGG + Intergenic
1020080034 7:5282229-5282251 GGGAGAAAAGAGGAGGATGGAGG + Intronic
1020321245 7:6940173-6940195 GCGGGAAAACAGGAGCCTGGAGG + Intergenic
1021464597 7:20927856-20927878 GAGAGAAATAAGGAGCAAGCAGG + Intergenic
1021857080 7:24867461-24867483 GAGAGGTAACTGGATCATGGGGG + Intronic
1022560344 7:31341937-31341959 AAGAGAAAACAGGAGGAAGGTGG - Intergenic
1022663795 7:32389935-32389957 GAGAGAAGACATGAGGATGAAGG - Intergenic
1023166303 7:37346977-37346999 GAGAGAGCAAAGGAGCAAGGAGG + Intronic
1023400091 7:39786519-39786541 GAAAGAAGAAATGAGCATGGTGG + Intergenic
1023672120 7:42588083-42588105 GAGAGGAAACAAGAGAATCGAGG - Intergenic
1024073020 7:45802269-45802291 GAAAGAAGAAATGAGCATGGTGG + Intergenic
1024109194 7:46128386-46128408 GACAGAAAAGGGGAGTATGGAGG - Intergenic
1024251146 7:47506561-47506583 GAGAGAGGGCAGGAGCAGGGAGG - Intronic
1024528772 7:50373136-50373158 GGAAGGAAACAGAAGCATGGGGG - Intronic
1024650313 7:51397915-51397937 GAAAGAAGAAATGAGCATGGTGG - Intergenic
1024860754 7:53837169-53837191 GAGAGATGACTGGATCATGGGGG - Intergenic
1025054456 7:55753568-55753590 GAAAGAAGAAATGAGCATGGTGG - Intergenic
1025132508 7:56383720-56383742 GAAAGAAGAAATGAGCATGGTGG - Intergenic
1025142055 7:56474804-56474826 TAGAGAAAACAGGACCCTGCTGG + Intergenic
1025151744 7:56560266-56560288 GAAAGAAAAGCTGAGCATGGTGG - Intergenic
1025183555 7:56838150-56838172 GAAAGAAGACATGAGCATGGTGG - Intergenic
1025198882 7:56949987-56950009 GGGAGAAAAGAGGAGGATGGAGG - Intergenic
1025250854 7:57350467-57350489 GAGGGACAGCAGGGGCATGGGGG - Intergenic
1025673064 7:63626946-63626968 GGGAGAAAAGAGGAGGATGGAGG + Intergenic
1025688371 7:63738817-63738839 AAGAAAAAACATGAGCATGGTGG + Intergenic
1026085331 7:67258535-67258557 GCGGGAAAACATGAGCATAGGGG + Intergenic
1026131836 7:67627380-67627402 TTGAGAAAACAGAAGTATGGAGG + Intergenic
1026389731 7:69888351-69888373 GAGAGGAAACAAGAGGATGGGGG + Intronic
1026996091 7:74617619-74617641 GAGAGGAAATAGGAGCAGGGAGG - Intergenic
1027590346 7:80111744-80111766 GAGAGGAAGCAGGGGCAGGGAGG - Intergenic
1027598427 7:80206967-80206989 GAGTGAAACCAGGAGTAAGGGGG + Intronic
1028028244 7:85874427-85874449 GAGAGTCAACAAGAGCAAGGAGG - Intergenic
1028262784 7:88685651-88685673 GAAAGAAAGAAGGAGGATGGAGG - Intergenic
1028462621 7:91112870-91112892 GAGAGAGAACAGGGGAAGGGGGG + Intronic
1028922546 7:96323386-96323408 GAGAGACAACGGAATCATGGGGG - Intergenic
1029627118 7:101726851-101726873 GATTGAAGACAGGACCATGGGGG - Intergenic
1029677085 7:102077230-102077252 CAGAGAAAGCAGCAGCAGGGAGG + Intronic
1031618079 7:123904480-123904502 CAGAGAAGACAGGAACATGATGG - Intergenic
1031903065 7:127430581-127430603 GAGAGCAAGCAGAAGCAGGGTGG - Intronic
1032050407 7:128645964-128645986 GAAAGAAGAAATGAGCATGGTGG + Intergenic
1032062108 7:128733610-128733632 TGGAGAAAACTGGAGCAAGGAGG - Intergenic
1032089557 7:128904416-128904438 GAGAGAAAGAGGGAGGATGGTGG - Intronic
1032608037 7:133379110-133379132 GAGAGAAAACAGGAAAAAAGTGG - Intronic
1032966369 7:137103246-137103268 GAGAGCAAGCAGAAGCAAGGTGG + Intergenic
1033157739 7:138971266-138971288 GAGAGAGGACAGCAGCGTGGGGG - Intronic
1033429971 7:141280377-141280399 GGGAGATAACAGAATCATGGGGG + Intronic
1033537930 7:142329023-142329045 GAGAGACAACATGAGGGTGGGGG - Intergenic
1033537948 7:142329088-142329110 GAGAGACAACATGAGGGTGGGGG - Intergenic
1033551488 7:142451871-142451893 GAGAGAAAACATGAGGGTGGGGG - Intergenic
1033609852 7:142954547-142954569 GAGAGAAGCAGGGAGCATGGCGG + Intronic
1033664205 7:143425156-143425178 GAGAGAAAGAAAAAGCATGGGGG - Intergenic
1033665914 7:143440349-143440371 CAGGAAAGACAGGAGCATGGCGG + Intergenic
1034242247 7:149619620-149619642 GAGGGAAGGCAGGAGCATAGTGG - Intergenic
1034310522 7:150083786-150083808 GAGAGAAAACAGCAGTATGGAGG - Intergenic
1034627847 7:152507152-152507174 GAGAGATAACATGGGGATGGTGG + Intergenic
1034796317 7:154016844-154016866 GAGAGAAAACAGCACTATGGAGG + Intronic
1035452263 7:158985122-158985144 GGGAGATAACAGAATCATGGGGG - Intergenic
1035632334 8:1117557-1117579 GAGAAGAAACAGGCTCATGGTGG + Intergenic
1036380279 8:8232204-8232226 GCGGGAAAACAGGAGACTGGAGG - Intergenic
1036482073 8:9148853-9148875 GAGAGAGAATAAGAGAATGGAGG - Intronic
1036849279 8:12190456-12190478 GCGGGAAAACAGGAGCCTGGAGG + Intronic
1036870639 8:12432730-12432752 GCGGGAAAACAGGAGCCTGGAGG + Intronic
1037691740 8:21186530-21186552 TAAAGAGAAGAGGAGCATGGAGG - Intergenic
1038228401 8:25677953-25677975 GAGAGAAAACTGCAGCACAGTGG - Intergenic
1038432153 8:27509056-27509078 TAGAGAAAAAAGCAGGATGGGGG - Intronic
1038569815 8:28651262-28651284 TAGTGCAAACAGCAGCATGGTGG - Intronic
1039057578 8:33548908-33548930 GAGAGACAACTGGAGCAGCGTGG - Intronic
1040660859 8:49573447-49573469 GAAAGAAGCCAGTAGCATGGTGG - Intergenic
1040847290 8:51857036-51857058 GAGAGAAAGCACGAGCACTGAGG + Intronic
1041226374 8:55702876-55702898 GAGGAAATAAAGGAGCATGGAGG + Intronic
1041370634 8:57156542-57156564 AAGATAAAACAGGAGCTTGCAGG + Intergenic
1041617521 8:59925271-59925293 GAGAGAGAAGAGGAGAATGAGGG + Intergenic
1041762818 8:61385089-61385111 GAAAGGGAGCAGGAGCATGGTGG + Intronic
1042140717 8:65675692-65675714 GTGAGAAAACAGAAGCATAGAGG + Intronic
1042695580 8:71551123-71551145 GAGAGAAGACTGGACCATGTGGG + Intronic
1043080728 8:75761529-75761551 GAGAGAAAACTGAATCATGGAGG + Intergenic
1043123161 8:76357025-76357047 GAGAATAAAAAGGAGCACGGAGG + Intergenic
1043351581 8:79367562-79367584 GAGAGAAATCTGGACCAAGGAGG - Intergenic
1043869339 8:85414230-85414252 AATTGAAAACAGGATCATGGAGG - Intronic
1044759507 8:95503142-95503164 GAGGGAAGAAAGGAGAATGGAGG - Intergenic
1045178337 8:99751777-99751799 GATAGAAAACATGAGAATGCTGG + Intronic
1045734296 8:105277010-105277032 GAGACAAAACTGGAGGATGGTGG - Intronic
1045761138 8:105609249-105609271 GAGGCAAGCCAGGAGCATGGAGG + Intronic
1047428305 8:124766859-124766881 GAGAGCAAAGAGGAGGATGCTGG + Intergenic
1047437490 8:124847059-124847081 GAGAGGAACCAGGAGCACAGGGG + Intergenic
1047735072 8:127757929-127757951 AAGAGAAAACAGGTGCAAGTAGG + Intergenic
1047767666 8:128002636-128002658 GAGAGGACACAGGAGGATGGAGG - Intergenic
1048194533 8:132321506-132321528 GAGAGCAAACAGAAGCAGGAGGG - Intronic
1048296686 8:133220011-133220033 GGGAGAAAAGTGGAGCAGGGAGG - Intronic
1048539779 8:135332324-135332346 GAGAGAACAATGTAGCATGGGGG - Intergenic
1048824289 8:138408794-138408816 GAGAGGTAACTGGATCATGGGGG - Intronic
1049226102 8:141451255-141451277 GAGAGAAAAAAGCAGCGTGGGGG + Intergenic
1050040817 9:1491438-1491460 GAAAGAAAATTGGAGCATGAGGG - Intergenic
1050345345 9:4680112-4680134 GAAAGAAAACATGTGCGTGGAGG - Intronic
1050563109 9:6854924-6854946 GAGAGAAAATTGAGGCATGGAGG - Intronic
1050870579 9:10563993-10564015 GAGAGAAAAAAAGAGGATGTAGG - Intronic
1051298200 9:15618802-15618824 GAGAGCAAGCAGAAGCAGGGTGG - Intronic
1051698090 9:19789873-19789895 GGGAGAGAACAGAAGGATGGAGG - Intergenic
1051872266 9:21752067-21752089 TAGAGAACACTGGAGGATGGGGG + Intergenic
1052992143 9:34524835-34524857 GAGAGAAAAGGAGAGCATTGAGG + Intergenic
1053265072 9:36706583-36706605 GAGAGATAATTGAAGCATGGGGG - Intergenic
1053885465 9:42642248-42642270 GAGAGAAATCAAGAGCAAGAAGG - Intergenic
1054224484 9:62449697-62449719 GAGAGAAATCAAGAGCAAGAAGG - Intergenic
1054728422 9:68676289-68676311 GAGAGGAAGCAGGTGGATGGAGG - Intergenic
1055910188 9:81341698-81341720 GGGAGATAACTGGATCATGGGGG - Intergenic
1058742183 9:107954904-107954926 GAGAGGAAAGAGGAGGAAGGAGG - Intergenic
1059076093 9:111195573-111195595 TAGAGGCAACAGGGGCATGGGGG - Intergenic
1060546536 9:124465173-124465195 GAGAGAGACCAGGAGGATGGAGG - Intronic
1060621472 9:125070933-125070955 GAGAGATAATTGGATCATGGGGG + Intronic
1060865130 9:126989407-126989429 GAGAGCATACAGCAGCGTGGAGG + Intronic
1061315888 9:129795572-129795594 GAGAGAGAGCAGGTGCCTGGGGG + Intergenic
1061479162 9:130888074-130888096 GAGAGAGAACAGGCGCACGTGGG - Intergenic
1062267069 9:135691883-135691905 GAGAGATGACTGGATCATGGGGG + Intergenic
1062414861 9:136443196-136443218 AAGCGAATACAGGAGCACGGAGG + Intronic
1062415648 9:136448280-136448302 CAGAGACACCAGGAGAATGGAGG + Intronic
1062415656 9:136448317-136448339 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415665 9:136448355-136448377 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415676 9:136448392-136448414 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415687 9:136448429-136448451 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415695 9:136448466-136448488 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415706 9:136448504-136448526 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415740 9:136448650-136448672 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415748 9:136448686-136448708 CAGAGACACCAGGAGAATGGAGG + Intronic
1062415758 9:136448724-136448746 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415769 9:136448762-136448784 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415778 9:136448800-136448822 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415786 9:136448836-136448858 CAGAGACACCAGGAGGATGGAGG + Intronic
1062707045 9:137951517-137951539 GAGAGAAACCAGGAGGGTGGTGG - Intronic
1062725583 9:138071595-138071617 GAGAGAAGCCAGGAGGAAGGGGG + Intronic
1203431706 Un_GL000195v1:95708-95730 CAGAGGAAAAAGGAGCACGGAGG - Intergenic
1203434793 Un_GL000195v1:128893-128915 CAGAGGAAAAAGGAGCATGGAGG + Intergenic
1185545400 X:939789-939811 AAGAGAAAAGAGGAGGAGGGGGG - Intergenic
1186668500 X:11744504-11744526 GTGAGAAAACAGGAGCTGGGAGG + Intergenic
1186918485 X:14249561-14249583 GAGAGAAGCCAGGAGCATGCAGG - Intergenic
1187746631 X:22416210-22416232 GAGAGATGACTGGATCATGGGGG + Intergenic
1188220047 X:27530360-27530382 TATAGAAAACAGAAGAATGGCGG - Intergenic
1188251094 X:27895892-27895914 GAGACAAAAAAGTAGAATGGTGG - Intergenic
1189674462 X:43446845-43446867 GAGAGATAACTGAATCATGGAGG + Intergenic
1190080989 X:47356626-47356648 GACAGACAACAGTAGCATTGTGG - Intergenic
1191132703 X:57031301-57031323 GAGAGCAAGCAGAAGCAGGGTGG - Intergenic
1192129604 X:68536753-68536775 GAGAGAAAAGAGGTTCAAGGAGG - Exonic
1192143656 X:68665888-68665910 GAGAGAAAACAGGTAAGTGGAGG + Intronic
1192215676 X:69156585-69156607 GGGAGGAAACAGGAGGAAGGGGG + Intergenic
1192437856 X:71153850-71153872 GAGAGAAAGCAGGACCACTGAGG + Intronic
1192960561 X:76126613-76126635 GAGAGCAAAGAGAAGCAGGGTGG + Intergenic
1193388542 X:80899502-80899524 GAAAGAAAACAGAAAAATGGAGG - Intergenic
1194257056 X:91646968-91646990 GAGAGATAACTGAATCATGGGGG + Intergenic
1194899951 X:99497781-99497803 GAGAGAAACAAAGAGCTTGGAGG + Intergenic
1195215962 X:102702608-102702630 GAGATAAAACAGGAGAACTGTGG + Intergenic
1195424533 X:104713439-104713461 GAGTGAAAACAAGAGTAAGGTGG - Intronic
1197314053 X:124942016-124942038 GAGAGAAAATTGAATCATGGGGG - Intronic
1197743797 X:129916564-129916586 AAGAGAAAATAGGAGCATAAGGG - Intronic
1198073055 X:133168675-133168697 GAGAGACCAAAGCAGCATGGAGG - Intergenic
1198148087 X:133878995-133879017 GGGAAAATACAGGAACATGGTGG + Intronic
1198327198 X:135585470-135585492 GAGAGAGAAGAGGAGAAGGGAGG + Intergenic
1198387229 X:136141000-136141022 GAGAGAGAAGAGAGGCATGGTGG + Intergenic
1198561779 X:137858233-137858255 GGGAGGAAACAGGAGGCTGGGGG + Intergenic
1198628787 X:138610997-138611019 GATAGTAAAAAGGAACATGGAGG - Intergenic
1199806349 X:151304705-151304727 GAGAGAAAGCGTGAGCAAGGGGG + Intergenic
1200166684 X:154040428-154040450 GAGAGAAAACAAGGGGGTGGGGG + Intronic
1200575766 Y:4886234-4886256 GAGAGAGAACTGAATCATGGGGG + Intergenic
1200740347 Y:6847096-6847118 GAGAGCAAGCAGGAGCAGGGTGG - Intergenic
1200832612 Y:7702153-7702175 GAGAAAAAAATGGAGCAAGGTGG + Intergenic
1201362298 Y:13166126-13166148 GAAAGAACAAAGGATCATGGTGG - Intergenic
1201376662 Y:13330374-13330396 GAGGGCAAACAGAAGCAGGGTGG + Intronic
1201774159 Y:17645954-17645976 GAGAGAAAAGAGGACCACGGGGG - Intergenic
1201827398 Y:18260035-18260057 GAGAGAAAAGAGGACCACGGGGG + Intergenic
1202261003 Y:22970243-22970265 GTGAGTCAACAGGAGCATGTAGG + Intergenic
1202413991 Y:24603984-24604006 GTGAGTCAACAGGAGCATGTAGG + Intergenic
1202456793 Y:25066102-25066124 GTGAGTCAACAGGAGCATGTAGG - Intergenic