ID: 976213103

View in Genome Browser
Species Human (GRCh38)
Location 4:82691770-82691792
Sequence TTAGGAAACCAGCTGGTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 280}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976213103_976213112 3 Left 976213103 4:82691770-82691792 CCTTGCACCAGCTGGTTTCCTAA 0: 1
1: 0
2: 0
3: 16
4: 280
Right 976213112 4:82691796-82691818 GAAGCTGGGGCCATGGTCTTTGG 0: 1
1: 0
2: 0
3: 19
4: 241
976213103_976213109 -10 Left 976213103 4:82691770-82691792 CCTTGCACCAGCTGGTTTCCTAA 0: 1
1: 0
2: 0
3: 16
4: 280
Right 976213109 4:82691783-82691805 GGTTTCCTAAAGGGAAGCTGGGG 0: 1
1: 0
2: 2
3: 25
4: 210
976213103_976213115 8 Left 976213103 4:82691770-82691792 CCTTGCACCAGCTGGTTTCCTAA 0: 1
1: 0
2: 0
3: 16
4: 280
Right 976213115 4:82691801-82691823 TGGGGCCATGGTCTTTGGAGGGG 0: 1
1: 0
2: 1
3: 20
4: 246
976213103_976213116 11 Left 976213103 4:82691770-82691792 CCTTGCACCAGCTGGTTTCCTAA 0: 1
1: 0
2: 0
3: 16
4: 280
Right 976213116 4:82691804-82691826 GGCCATGGTCTTTGGAGGGGTGG 0: 1
1: 1
2: 1
3: 28
4: 277
976213103_976213114 7 Left 976213103 4:82691770-82691792 CCTTGCACCAGCTGGTTTCCTAA 0: 1
1: 0
2: 0
3: 16
4: 280
Right 976213114 4:82691800-82691822 CTGGGGCCATGGTCTTTGGAGGG 0: 1
1: 0
2: 0
3: 15
4: 209
976213103_976213111 -4 Left 976213103 4:82691770-82691792 CCTTGCACCAGCTGGTTTCCTAA 0: 1
1: 0
2: 0
3: 16
4: 280
Right 976213111 4:82691789-82691811 CTAAAGGGAAGCTGGGGCCATGG 0: 1
1: 0
2: 1
3: 25
4: 299
976213103_976213113 6 Left 976213103 4:82691770-82691792 CCTTGCACCAGCTGGTTTCCTAA 0: 1
1: 0
2: 0
3: 16
4: 280
Right 976213113 4:82691799-82691821 GCTGGGGCCATGGTCTTTGGAGG 0: 1
1: 0
2: 1
3: 19
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976213103 Original CRISPR TTAGGAAACCAGCTGGTGCA AGG (reversed) Intronic
901000199 1:6145213-6145235 TTAGGGAACAGGCTGCTGCACGG - Intronic
902031921 1:13429196-13429218 TTAGGAAACCTGCTGGGTTAAGG - Intergenic
902051799 1:13569047-13569069 TTAGGAAACCTGCTGGGTTAAGG - Intergenic
904713135 1:32446708-32446730 TTAGGAAACCTGCTGGGTTAAGG + Intergenic
905567790 1:38979661-38979683 TTAGGAAACCTGCTGGGTTAAGG + Intergenic
906507585 1:46391696-46391718 TTAGGAAACCTGCTGGGTTAAGG + Intergenic
906601139 1:47130322-47130344 TTAGGAAATCTGCTGGGGTAAGG + Intergenic
908300880 1:62760103-62760125 TTAGGAAACCTGCTGGGTTAAGG - Intergenic
910007300 1:82414063-82414085 TTTGGAAAAGAGCTTGTGCATGG + Intergenic
910396981 1:86803328-86803350 TTAGGAAACCTGCTGGGTTAAGG + Intergenic
910808257 1:91210316-91210338 TTAGGAAACCTGCTGGGTTAAGG + Intergenic
912815865 1:112827553-112827575 TTAGGAAACCTGCTGGGTTAAGG - Intergenic
913713713 1:121512609-121512631 TTAGGAAACCTGCTGGGTTAAGG - Intergenic
917227788 1:172802458-172802480 TTAGGAAACCTGCTGGGTTAAGG - Intergenic
917460027 1:175221704-175221726 GAAGGAAACCAGCTGGCTCAGGG + Intergenic
918103257 1:181394904-181394926 ACAGGAAGCCAGATGGTGCAGGG + Intergenic
918136327 1:181677294-181677316 TTATGAAACCAGCTGAGACACGG - Intronic
919559164 1:199096290-199096312 TTAGGAAACCTGCTGGGTTAAGG - Intergenic
920312935 1:205059044-205059066 TGAGGAAACCAGGGGGTGCTGGG - Intronic
920425384 1:205870907-205870929 TTAGGAAACCCGCTGGGTTAAGG + Intergenic
921810078 1:219502574-219502596 TCAGGAAACCACCTGGTGTGTGG + Intergenic
922522873 1:226272607-226272629 TTAGGAAAAAAGCTGAGGCAGGG + Intronic
923077302 1:230621460-230621482 TGGGGAAGCCAGCTGCTGCATGG + Intergenic
923769352 1:236924535-236924557 ATAGTCAATCAGCTGGTGCACGG + Intergenic
924218964 1:241854023-241854045 TAAGGAAAGAAGCTGCTGCAAGG - Intronic
924859227 1:247904205-247904227 TTAGGAAACCTGCTGGGTTAAGG + Intergenic
924886954 1:248229213-248229235 CTAGGGAACCAGCAGGAGCAGGG + Intergenic
1063408694 10:5819902-5819924 TTAGGAAACGACCAGGTGTATGG - Intronic
1063415158 10:5867203-5867225 TTAGGAAACCTGCTGGGTTAAGG - Intronic
1063684568 10:8224542-8224564 TTAGGAAACCAGGAGATCCATGG - Intergenic
1064629039 10:17290692-17290714 CTAAGACACCAGCTGGTTCAAGG + Intergenic
1065810350 10:29437452-29437474 TTAGGAAACCTGCTGGGTTAAGG + Intergenic
1065930844 10:30477299-30477321 TTAGGAAACCTGCTGGGTTAAGG - Intergenic
1068632666 10:59313618-59313640 TTGGGAAACCAACTTGTCCAAGG + Intronic
1069939081 10:71941520-71941542 TTAGGAAACCTGCTGGGTTAAGG - Intergenic
1071052257 10:81465342-81465364 TTAGGAAAGTAACTGGTGCAAGG - Intergenic
1071327180 10:84529069-84529091 TTAGGAAACCTGCTGGGTTAAGG + Intergenic
1072701769 10:97647105-97647127 TTCTGACACCAGCTGGTGCATGG + Intronic
1074283133 10:112072090-112072112 ATAGGAAACTTGCTGCTGCATGG + Intergenic
1074742437 10:116498287-116498309 TTAGGAAACCTGCTGGGTTAAGG + Intergenic
1075146792 10:119889259-119889281 TTAGGAAACCTGCTGGGTTAAGG - Intronic
1076079650 10:127567439-127567461 TAAGGCAACCAGCTAGTGAATGG - Intergenic
1076406270 10:130214287-130214309 TCAGGAAAACAGCTGCTGCTGGG - Intergenic
1077394859 11:2315812-2315834 GCAGGAAGCCAGCTGGTGGAGGG - Intronic
1079225709 11:18603019-18603041 GTAGGAATCCAGATGGTGGATGG - Intergenic
1079255040 11:18820451-18820473 TTAGGAAACCTGCTGGGTTAAGG + Intergenic
1079256260 11:18834118-18834140 TTAGGTGATCAGCTGGTTCATGG + Intergenic
1079811196 11:25001472-25001494 TTAGGAAACCTGCTGGGTTAAGG + Intronic
1081033652 11:38115470-38115492 TTAGGAAACCGGCTGGGTTAAGG - Intergenic
1081070397 11:38603507-38603529 TTAGGAAACCTGCTGGGTTAAGG - Intergenic
1081146348 11:39565568-39565590 TTAGGAAACCTGCTGGGTTAAGG - Intergenic
1083089730 11:60187306-60187328 TTAGGAAACCTGCTGGGTTAAGG - Intergenic
1085239634 11:75041945-75041967 TTAGGAAACCTGCTGGGTTAAGG - Intergenic
1086973596 11:93109000-93109022 TTAGGAAACCTGCTGGGTTAAGG + Intergenic
1087640215 11:100748450-100748472 TTAGGAAACCTGCTGGGTAAGGG + Intronic
1087896843 11:103595489-103595511 TTAGGAAACCACGTGCTTCATGG + Intergenic
1091387842 12:105911-105933 TTGGGAAACCTGTTGGTGCTTGG + Intronic
1091839354 12:3608498-3608520 TTGGGAAACCATATGGTGCTTGG - Intronic
1093348390 12:18068438-18068460 TTAGGAAACCTGCTGGGTTAAGG - Intergenic
1093594290 12:20943043-20943065 TTAGGAAACCTGCTGGGTTAAGG + Intergenic
1094220062 12:27983199-27983221 TTATAAAACCAGCTGGTAAAAGG - Intergenic
1094319535 12:29170341-29170363 TTAGGAAACCTGCTGGGTTAAGG + Intronic
1095906201 12:47380560-47380582 GTAGGAAAACAGCTGTTGCATGG - Intergenic
1096344877 12:50837046-50837068 GTAGGAAAACAGCTGTTGAATGG + Intergenic
1098248240 12:68542156-68542178 TTAGGAAACCTGCTGGGTTAAGG - Intergenic
1099647087 12:85371060-85371082 TTAGGAAAGCAGTTTGTGCAAGG + Intergenic
1106163183 13:27218557-27218579 TTAGGAAACCTGCTGGGTTAAGG - Intergenic
1106545259 13:30725575-30725597 CTAGAAAACCAACTGGTGGAAGG + Intronic
1109734746 13:66468066-66468088 TTAGATATCCAGCTGGAGCATGG - Intronic
1109909679 13:68892880-68892902 TTAGGAAACCTGCTGGGTTAAGG + Intergenic
1112077931 13:95933193-95933215 TTATGAATCCATCTGGTCCAGGG + Intronic
1114236276 14:20826841-20826863 TTAGGAAACCTGCTGGGTTAAGG + Intergenic
1119528167 14:75339432-75339454 TTAGGAAACCAGCAGTTAGAAGG - Intergenic
1121122066 14:91382324-91382346 TCTGGAAACCACCTGGTCCAGGG - Intronic
1121979917 14:98445831-98445853 TTCTCAGACCAGCTGGTGCATGG - Intergenic
1124106611 15:26743766-26743788 GTAGGAATGCAACTGGTGCAAGG - Intronic
1124145892 15:27124748-27124770 TGAGGCAACAAGCTGGTGCCTGG - Intronic
1127032659 15:54880964-54880986 GTAGGAAGCCATCTGGGGCATGG + Intergenic
1130397019 15:83511748-83511770 TGAGGGAACCAGCAGGTGCGCGG - Intronic
1131278469 15:91002005-91002027 TCAGGACAACAGCTGGAGCAGGG + Intronic
1131325048 15:91434862-91434884 GTTAGAAACCAGCTGGTGAAGGG + Intergenic
1131371752 15:91887567-91887589 TTTAGAACCCAGCTGGTGCCAGG + Intronic
1134129919 16:11642307-11642329 TTATGAAACCATGTGGTGCAGGG + Intergenic
1135339178 16:21631685-21631707 TTAGGAAACCTGCTGGGTTAAGG + Intronic
1137041742 16:35619425-35619447 TTAGGAAACCTGCTGGGTTAAGG + Intergenic
1137583826 16:49651907-49651929 TTTGAAAACCATCTTGTGCACGG - Intronic
1139714920 16:68805308-68805330 ATAGGATACCAGGTGGGGCACGG - Intronic
1142908911 17:3070509-3070531 TTAGGGAACTAGCTGATGCCAGG + Intergenic
1142925654 17:3233733-3233755 TTAGGGAACTAGCTGATGCCAGG - Intergenic
1143535711 17:7538002-7538024 TCAGGAAACAAGCTGGGTCAAGG - Intergenic
1147228066 17:38996328-38996350 TTAGGAAAGCAGCTGCCACAAGG - Intergenic
1148829119 17:50418576-50418598 TTAGGAAACCTGCTGGGTTAAGG + Intergenic
1152453542 17:80399170-80399192 TTAGGAAACCTGCTGGGTTAAGG - Intergenic
1152470381 17:80487802-80487824 TGAGGAAAGCAGCCTGTGCAAGG + Intergenic
1152554524 17:81046253-81046275 TTAGGAAACGAGGGGATGCATGG - Intronic
1152692437 17:81725552-81725574 TCAGAAAACCAGCTGGGCCATGG - Intergenic
1153826573 18:8880743-8880765 TTAGGAAACCTGCTGGGTTAAGG + Intergenic
1155746364 18:29360545-29360567 TTAGGAAACCTGCTGGGTTAAGG + Intergenic
1156301058 18:35836417-35836439 TTAGGAAAGCAGCTGGGTTAAGG - Intergenic
1156426488 18:37019386-37019408 TTAGGCAATGAGCTGGTTCATGG + Intronic
1161597747 19:5160000-5160022 TTAGGAAACCTGCTGGGTTAAGG + Intronic
1162108372 19:8385205-8385227 TTAGGAAACCTGCTGGGTTAAGG - Intronic
1164476738 19:28581306-28581328 TTTGAAAAAAAGCTGGTGCATGG - Intergenic
1164477064 19:28583889-28583911 TTAGCACAACATCTGGTGCACGG - Intergenic
1164521984 19:28986372-28986394 ATAGGGAGCCAGCTGGTTCAGGG + Intergenic
1164598606 19:29546585-29546607 TTAGCAATCCAGATGGGGCAGGG + Intronic
1165016293 19:32882653-32882675 TTAGGTTACCAGTTGATGCAGGG - Intronic
1165740162 19:38200384-38200406 TTAGGAAACCTGGTGGTCCCTGG - Intronic
1168562530 19:57396032-57396054 CACGGAAACCAGGTGGTGCACGG - Intronic
925109462 2:1321616-1321638 TCAGGAAGCCAGATGGTGCCAGG + Intronic
925355057 2:3234894-3234916 TTAGCTAACCAGCTGGTCCCGGG + Intronic
925949410 2:8896910-8896932 TTAGGAAACCTGCTGGGTTAAGG + Intronic
929770975 2:44891810-44891832 TCATGAAAGCAGCTGGGGCAGGG - Intergenic
931837001 2:66109513-66109535 TTAGTAGACCAGCTGTTGCTGGG + Intergenic
933342368 2:81039213-81039235 TTAGGAAACCTGCTGGGTTAAGG - Intergenic
933420712 2:82042688-82042710 TAAGGACACCAGCTGCAGCAGGG + Intergenic
934867579 2:97826905-97826927 TTAGGAAACCTGCTGGGTTAAGG - Intronic
935247877 2:101235021-101235043 TTAGGAAACCTGCTGGGTTAAGG - Intronic
937236880 2:120436551-120436573 TTGGAGAACCAGCTGCTGCAGGG - Intergenic
938283170 2:130082138-130082160 TTAGGAATCGTGCTGGTACATGG + Intronic
938432440 2:131256762-131256784 TTAGGAATCGTGCTGGTACATGG - Intronic
938805729 2:134805669-134805691 TTAGGAAACCTGCTGGGTTAAGG + Intergenic
941362691 2:164572072-164572094 TTACCAAAACAGCTGATGCAGGG + Intronic
941537349 2:166740208-166740230 TTAGGAAACCTGCTGGCTTAAGG + Intergenic
942101926 2:172592082-172592104 TTAGGAAACCTGCTGGGTTAAGG + Intronic
942564231 2:177250763-177250785 TTAGGAAGCCAGGGGGTGCCAGG + Intronic
943102848 2:183508939-183508961 TTAGGAAACCTGCTGGGTTAAGG + Intergenic
943407942 2:187512396-187512418 TTAGGAAACCTGCTGGGTTAAGG - Intronic
944533708 2:200689381-200689403 GTAGGATACCAGCTGGTGTCTGG - Intergenic
945091908 2:206183525-206183547 TTAGGAACCTCTCTGGTGCAGGG - Intronic
945720104 2:213408552-213408574 TTAGGAAACCTGCTGGGTTAGGG - Intronic
946495704 2:220193191-220193213 TTATGAAACCACCTAGTGCCAGG - Intergenic
946573238 2:221047113-221047135 TTAGCAAACCAGGTGGGGAAGGG - Intergenic
946686147 2:222272293-222272315 TTGGGAAACATGCTGGTGCTTGG - Intronic
947314228 2:228837777-228837799 TTTTGAAGCCAGCTGGTGAAAGG - Intergenic
1169261435 20:4141379-4141401 TTAGAAAACAAGAAGGTGCATGG - Intronic
1171167503 20:22984836-22984858 TTAGGGAACCAGCGGCTCCAGGG - Intergenic
1171261823 20:23740848-23740870 TTAGGAAACCTGCTGGGTTAAGG - Intergenic
1171473283 20:25389579-25389601 TTAGGAAACCAGCAGATGGGAGG + Intronic
1173675381 20:44830323-44830345 TTACGCAAACAGATGGTGCATGG - Intergenic
1175391435 20:58630045-58630067 TCAGGAAACCAGCTAGTTCAGGG - Intergenic
1175514000 20:59557073-59557095 TTAGGAAACCTGCTGGGTTAAGG + Intergenic
1176413372 21:6460994-6461016 TTAGGAAACCACCTGGACCAGGG - Intergenic
1178109548 21:29356635-29356657 TTAGGAAACCTGCTGGGTTAAGG + Intronic
1178436535 21:32564258-32564280 CTGGGAAACCAACTGGTCCAGGG + Intergenic
1178836925 21:36106225-36106247 TTAGGAAACCTGCTGGGTTAAGG - Intergenic
1179183322 21:39063081-39063103 GTAGGAAGGAAGCTGGTGCATGG + Intergenic
1179688869 21:43069317-43069339 TTAGGAAACCACCTGGACCAGGG - Intronic
1180710326 22:17835217-17835239 TTGTGAAACCAGCTGATGCACGG - Intronic
1184536497 22:45091290-45091312 TGAGGGAACCAGGTGGTTCAGGG - Intergenic
951538533 3:23761335-23761357 TGAGGAGACCAGCTGGGGGAAGG + Intergenic
951603362 3:24401738-24401760 TTAGGGAAACTGCTGGTCCAGGG - Intronic
953622485 3:44545075-44545097 TTAGGAAACCTGCTGGGTTAAGG + Intergenic
954599257 3:51855043-51855065 TTAGGAAACCTGCTGGGTTAAGG - Intergenic
955131268 3:56171311-56171333 TTAGGGAGGCAGCTGGTGGAGGG - Intronic
956842619 3:73154602-73154624 TTAGGAAACCTGCTGGGTTAAGG + Intergenic
958000062 3:87739282-87739304 TTAGGAAACCTGCTGGGTTAAGG + Intergenic
958984211 3:100761525-100761547 TTAGCAAAACAGCTGCTGGATGG + Intronic
959249235 3:103919731-103919753 TTAGGAAACTACCAAGTGCATGG + Intergenic
960619314 3:119623594-119623616 ATAGGTAACCAGCGGCTGCAGGG + Intronic
960720529 3:120621108-120621130 TTAGGAAACCTGCTGGGTTAAGG + Intergenic
962097213 3:132304509-132304531 TTAGGAAACCTGCTGGGTTAAGG - Intergenic
962676432 3:137761765-137761787 CTAGGAGACAAGCTGATGCACGG + Intergenic
963021585 3:140877189-140877211 TTAGGAAACCTGCTGGGTTAAGG - Intergenic
963697200 3:148576548-148576570 TTAGGAAACCTGCTGGGTTAAGG - Intergenic
963988981 3:151631113-151631135 TGTGGAAACCAGCTGATGGAAGG - Intergenic
964178239 3:153851993-153852015 TTAAGAAACTAACTGGTGCTGGG + Intergenic
964933213 3:162050712-162050734 TTAGGAAACCTGCTGGGTTATGG + Intergenic
966519148 3:180854534-180854556 CTAGGCTACCAGCTTGTGCAGGG + Intronic
966643145 3:182212789-182212811 TTAGGAAATCAGCTGCCACATGG - Intergenic
967326787 3:188248786-188248808 TTACCAAACGAACTGGTGCAAGG - Intronic
967584128 3:191191578-191191600 TTAGGAAACCTGCTGGGTTAAGG - Intergenic
968197990 3:196725658-196725680 TTAGGAAACTACCTGATGCCAGG + Intronic
971669926 4:29543178-29543200 TGGGGAAACCAGCTGCAGCAGGG - Intergenic
972250382 4:37293652-37293674 TTATGAAACCAGATGGTGGATGG + Intronic
972781542 4:42290889-42290911 TTAGGAAACCTGCTGGGTTAAGG + Intergenic
975205497 4:71640138-71640160 TTAGGAAACCTGCTGGGTTAAGG - Intergenic
975631029 4:76402461-76402483 TGAGAAAAGCAGCTGTTGCAAGG - Intronic
976213103 4:82691770-82691792 TTAGGAAACCAGCTGGTGCAAGG - Intronic
977725863 4:100296349-100296371 CTTGGAACCCAGCTGCTGCAAGG - Intergenic
977834486 4:101632553-101632575 TTAGGAAACCTGCTGGGTTAAGG + Intronic
978833238 4:113115058-113115080 TTAGGAAAGAAGGTGGTTCAGGG - Intronic
979066043 4:116133873-116133895 TTAGGCAAACAGCTTGTGCAGGG + Intergenic
979593380 4:122505982-122506004 TTAGAGAACCAGCAGGTTCAGGG + Intergenic
980315407 4:131192944-131192966 TTAGGAATACAGCTGTTGCTAGG + Intergenic
980845795 4:138323051-138323073 TTAGGAAGTGAGCTGGAGCATGG - Intergenic
982098720 4:151947356-151947378 TTATGAAAGCAGCTGGGGCGGGG + Intergenic
982701591 4:158663798-158663820 TTAGGAAACCTGCTGGGTTAAGG - Intergenic
989964167 5:50449538-50449560 TTAGGAAACCTGCTGGGTTAAGG + Intergenic
990117048 5:52402248-52402270 TTAGGAAACCTGCTGGGTTAAGG - Intergenic
990367552 5:55086309-55086331 TTAGGAAACCTGCTGGGTTAAGG + Intergenic
990419363 5:55616391-55616413 TTAGGAAACCTGCTGGGTTAAGG - Intergenic
991572994 5:68075095-68075117 ATAGGAAACCAGATTGGGCAGGG - Intergenic
992455644 5:76913211-76913233 TTAGGAAACCTGCTGGGTTAAGG - Intronic
992929366 5:81626646-81626668 TCAGGAAATGAGTTGGTGCATGG - Intronic
993736974 5:91488965-91488987 TTAGGAAACCAGCTGAAGGTAGG + Intergenic
994861634 5:105202876-105202898 TTAGGATATCAGCAGGCGCAAGG + Intergenic
996098910 5:119427949-119427971 TTAGGAAACCTGCTGGGTTAAGG + Intergenic
996100309 5:119438636-119438658 TTAGGAAACCTGCTGGGTTAAGG - Intergenic
996839849 5:127836323-127836345 CTATGAAAGCAGCTGGGGCAGGG - Intergenic
996923180 5:128792195-128792217 TTAGGAAAGCAGATTGTGTAAGG - Intronic
997479445 5:134173035-134173057 TTAAAAAATCAGCTGGGGCAGGG + Intronic
997609065 5:135199043-135199065 TTAGCAAAACAGCTGATGCCAGG - Intronic
997715251 5:136037799-136037821 TAAAGAGATCAGCTGGTGCATGG + Intronic
998552723 5:143093036-143093058 TTAGGAAACCTGCTGGGTTAAGG + Intronic
998627586 5:143863151-143863173 TCAGGAATCCAGCTGGTAAATGG - Intergenic
998915387 5:147006028-147006050 TTAGGAAACCTGCTGGGTTAAGG - Intronic
998938837 5:147259121-147259143 TTAGGAAACCTGCTGGGTTAAGG + Intronic
1000236675 5:159367996-159368018 TTAGGAAACCTGCTGGGTTAAGG - Intergenic
1000605872 5:163327041-163327063 TTAGAAAAACAGCTAGGGCAGGG - Intergenic
1001245088 5:170100205-170100227 TATGGAAAACAGCTGCTGCAGGG - Intergenic
1002999279 6:2316255-2316277 TTAGGAAACCTGCTGGGTTAAGG + Intergenic
1004282861 6:14295711-14295733 CAAGGAAACCAGGTGGTGCTAGG - Intergenic
1005846577 6:29784811-29784833 TTAGGAAATCAGCATGGGCAAGG + Intergenic
1006222036 6:32499387-32499409 TTAGGAAACCTGCTGGGTTAAGG - Intergenic
1006504065 6:34476716-34476738 TTACCAGGCCAGCTGGTGCAAGG - Intronic
1008123317 6:47642309-47642331 TTAGGAAACCTGCTGGGTTAAGG - Intergenic
1008150090 6:47939632-47939654 AAAGGTAACCAACTGGTGCAAGG - Intronic
1008360510 6:50612126-50612148 TTAGAAAAACAGATGGTGGAGGG + Intergenic
1009635607 6:66260696-66260718 TTAGGAAACCTGCTGGGTTAAGG - Intergenic
1010075269 6:71790597-71790619 TTAGGAAACCTGCTGGGTTAAGG - Intergenic
1010722175 6:79295876-79295898 CTGTGAAACCATCTGGTGCAGGG + Intergenic
1011570193 6:88726497-88726519 TTAGGAAACCTGCTGGGTTAAGG - Intronic
1013017004 6:106168993-106169015 TGAGGAAACAAGCAGGAGCACGG + Intergenic
1013481775 6:110558910-110558932 TTGGCAAACCACCAGGTGCAAGG - Intergenic
1013977614 6:116095103-116095125 TTAGGAAACCTGCTGGATTAAGG - Intergenic
1015171797 6:130262464-130262486 TTAGGAAACCTGCTGGGTTAAGG - Intronic
1017225122 6:152012428-152012450 TTAGCATCACAGCTGGTGCAGGG - Intronic
1020044041 7:5027045-5027067 TTAGGAAACCTGCTGGGTTAAGG + Intronic
1020507939 7:9017744-9017766 TTAGGAAACCTGCTGGGTTAAGG - Intergenic
1022489986 7:30809427-30809449 TTAGGAAACCTGCTGGGTTAAGG - Intronic
1022612613 7:31892106-31892128 TTATAAAACCAGCTGGGGAAAGG - Intronic
1025798267 7:64759931-64759953 TTAGGAAACCTGCTGGGTTAAGG + Intergenic
1026204682 7:68246568-68246590 TCAGCCAAGCAGCTGGTGCATGG + Intergenic
1027682131 7:81233803-81233825 GGAGGAATCCAGCTGCTGCAGGG - Intergenic
1028256934 7:88610616-88610638 CCAGGAAACCAGCAGGTTCAAGG + Intergenic
1028333806 7:89626850-89626872 TTAGGAAACCTGCTGGGTTAAGG - Intergenic
1028793582 7:94879668-94879690 TTAGGAAACCTGCTGGGTTAAGG - Intergenic
1029195818 7:98804534-98804556 TTTGAAGACCAGCTGGTGCTGGG - Intergenic
1029546770 7:101214476-101214498 TGAGGAAAACAGCTTGTGGAGGG - Intronic
1029878399 7:103779114-103779136 TTTGGAAAACTGCTGATGCAAGG - Intronic
1030117294 7:106071569-106071591 TGAGGAAACCAGCTTTTCCAGGG + Intergenic
1030420702 7:109303268-109303290 TTAGGAAACCTGCTGGGTTAAGG - Intergenic
1030994394 7:116340745-116340767 TTAAGAAACCATATGGGGCAGGG + Intronic
1032426291 7:131824733-131824755 TTAGGAAACCTGCTGGGTTAAGG + Intergenic
1034579449 7:152029858-152029880 TTAGGAAACCTGCTGGGTTAAGG + Intronic
1036439172 8:8765070-8765092 TTAGGATTTCAGCTGGTGAAGGG + Intergenic
1036667165 8:10754526-10754548 TGAGGAAACCTACTGGTGGATGG + Intronic
1037228589 8:16626001-16626023 TTAGGATACCAGGTGGGACATGG + Intergenic
1038237624 8:25775997-25776019 TTAGGAAACAAACTGATTCAAGG + Intergenic
1038653735 8:29429646-29429668 TAAGAAAACCAGTTGGTGTAGGG + Intergenic
1039276401 8:35937683-35937705 TTAGGAAACCTGCTGGGATAAGG - Intergenic
1039876979 8:41595273-41595295 TTAGGAAACCTGCTGGGTTAAGG + Intronic
1040667427 8:49651209-49651231 TTAGGAAACCTGCTGGGTTAAGG + Intergenic
1041226739 8:55707743-55707765 TTAGGAAACCTGCTGGGTTAAGG - Intronic
1043613402 8:82093608-82093630 TTAGGAAACCTGCTGGGTTAAGG + Intergenic
1044434773 8:92148956-92148978 GCAGGAAACCTGCTGTTGCAGGG + Intergenic
1047544078 8:125798086-125798108 TGAGGAAACCAGCTGCAGCAAGG - Intergenic
1048824908 8:138414931-138414953 ATAGGAAACCATTTGGTGCTTGG - Intronic
1048945818 8:139446071-139446093 TCAGGAAACCAGATGGGGCAGGG + Intergenic
1049877483 8:145034689-145034711 TTAGGAAACCTGCTGGGTTAAGG - Intergenic
1052289953 9:26829227-26829249 TTAGGAAACCTGCTGGGTTAAGG - Intergenic
1052529158 9:29658505-29658527 TTAGGAAACCTGCTGGGTTAAGG + Intergenic
1052538679 9:29778934-29778956 TTAGGAAACCTGCTGGGTTAAGG + Intergenic
1052568740 9:30192747-30192769 TTAAGAAAACAGCTTGTACAAGG - Intergenic
1053110969 9:35459856-35459878 TTAGGAAACCTGCTGGGTTAAGG + Intergenic
1054932814 9:70653754-70653776 TTAGTAAAGCAGATGGTGAAGGG - Intronic
1055531660 9:77190690-77190712 TTATGAATCCATCTGGTCCAGGG + Intronic
1056029802 9:82541351-82541373 TCAGGAAAATAGCTGGTGCCAGG + Intergenic
1057385272 9:94600973-94600995 TTAGGAAAGCAGTGGGTGCTAGG + Intergenic
1058092431 9:100820184-100820206 ATAGGAAACCAGCAGGTGTCAGG + Intergenic
1060529870 9:124341842-124341864 GGAGGAAACCTGCTGGTGTAGGG + Intronic
1186427621 X:9475968-9475990 TTAGGCATCCTGCTGGTACACGG - Intronic
1187685660 X:21813417-21813439 TTAGTAAAGCAGCTGTTGAAGGG + Intergenic
1187940223 X:24373906-24373928 TTAGGAAGCCAGGTGGGGCATGG + Intergenic
1188050172 X:25474843-25474865 CTAGGAGACCAGAGGGTGCAGGG + Intergenic
1188097976 X:26046032-26046054 TTAGGAAACCTGCTGGGTTAAGG - Intergenic
1188288005 X:28352641-28352663 TTAGCAAACAAGTTGGGGCATGG + Intergenic
1189834062 X:45003339-45003361 TTAGGAAACCTGCTGGGTTAAGG + Intronic
1190270059 X:48855607-48855629 TTAGGAAACCTGCTGGGTTAAGG - Intergenic
1190771063 X:53514571-53514593 TTAGGAAACCTGCTGGGTTAAGG - Intergenic
1191918131 X:66224437-66224459 TTAGGAAACCTGCTGGGTTAAGG + Intronic
1192482323 X:71496258-71496280 TTAGGAAACCTGCTGGGTTAAGG + Intronic
1192551613 X:72059126-72059148 CTGGAAAACCAGCAGGTGCAGGG - Intergenic
1193697565 X:84727363-84727385 TTATGAATCCATCTGGTCCAGGG + Intergenic
1195490764 X:105466876-105466898 TGAGGAAACAAGGTGGTGCAGGG + Intronic
1195675168 X:107502391-107502413 TGAGGAAACCAGTTGTTGCAGGG + Intergenic
1195969132 X:110455197-110455219 TTTGGAAACATGCTGGTGCTGGG - Exonic
1196126930 X:112110929-112110951 TTAGGAAACCTGCTGGGTTAAGG + Intergenic
1198041990 X:132861934-132861956 TTAAGAAACCATCTGTTCCATGG - Intronic
1198277411 X:135108861-135108883 TTATGAATCCATCTGGTCCAGGG + Intergenic
1198841846 X:140865511-140865533 GCATGACACCAGCTGGTGCAGGG - Intergenic
1199278385 X:145972051-145972073 TTAGGAAACCTGCTGGGTTAAGG - Intergenic
1199637598 X:149828131-149828153 TTAGGAAACCTGCTGGGTTAAGG - Intergenic
1200945500 Y:8831396-8831418 TTAGGAAACCTGCTGGGTTAAGG - Intergenic
1201648584 Y:16262011-16262033 TTAGGAAACCTGCTGGGTTAAGG + Intergenic
1201654226 Y:16323290-16323312 TTAGGAAACCTGCTGGGTTAAGG - Intergenic