ID: 976213175

View in Genome Browser
Species Human (GRCh38)
Location 4:82692239-82692261
Sequence AACCACTGCCATGGGTCCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 178}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976213164_976213175 26 Left 976213164 4:82692190-82692212 CCTGGCCATGCTGACCGACGCCA 0: 1
1: 0
2: 1
3: 6
4: 82
Right 976213175 4:82692239-82692261 AACCACTGCCATGGGTCCTGAGG 0: 1
1: 0
2: 0
3: 15
4: 178
976213169_976213175 -4 Left 976213169 4:82692220-82692242 CCTGCCCCAGCTCTACTGCAACC 0: 1
1: 0
2: 5
3: 39
4: 377
Right 976213175 4:82692239-82692261 AACCACTGCCATGGGTCCTGAGG 0: 1
1: 0
2: 0
3: 15
4: 178
976213172_976213175 -10 Left 976213172 4:82692226-82692248 CCAGCTCTACTGCAACCACTGCC 0: 1
1: 0
2: 1
3: 38
4: 530
Right 976213175 4:82692239-82692261 AACCACTGCCATGGGTCCTGAGG 0: 1
1: 0
2: 0
3: 15
4: 178
976213165_976213175 21 Left 976213165 4:82692195-82692217 CCATGCTGACCGACGCCATGATG 0: 1
1: 0
2: 0
3: 5
4: 57
Right 976213175 4:82692239-82692261 AACCACTGCCATGGGTCCTGAGG 0: 1
1: 0
2: 0
3: 15
4: 178
976213171_976213175 -9 Left 976213171 4:82692225-82692247 CCCAGCTCTACTGCAACCACTGC 0: 1
1: 0
2: 0
3: 34
4: 283
Right 976213175 4:82692239-82692261 AACCACTGCCATGGGTCCTGAGG 0: 1
1: 0
2: 0
3: 15
4: 178
976213167_976213175 12 Left 976213167 4:82692204-82692226 CCGACGCCATGATGGACCTGCCC 0: 1
1: 0
2: 0
3: 5
4: 70
Right 976213175 4:82692239-82692261 AACCACTGCCATGGGTCCTGAGG 0: 1
1: 0
2: 0
3: 15
4: 178
976213170_976213175 -8 Left 976213170 4:82692224-82692246 CCCCAGCTCTACTGCAACCACTG 0: 1
1: 0
2: 1
3: 28
4: 327
Right 976213175 4:82692239-82692261 AACCACTGCCATGGGTCCTGAGG 0: 1
1: 0
2: 0
3: 15
4: 178
976213168_976213175 6 Left 976213168 4:82692210-82692232 CCATGATGGACCTGCCCCAGCTC 0: 1
1: 0
2: 1
3: 24
4: 217
Right 976213175 4:82692239-82692261 AACCACTGCCATGGGTCCTGAGG 0: 1
1: 0
2: 0
3: 15
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976213175 Original CRISPR AACCACTGCCATGGGTCCTG AGG Intronic
904276367 1:29387375-29387397 AACCTCCGCCAAGGATCCTGGGG + Intergenic
906328153 1:44861705-44861727 AACCACTGCTGTGGAGCCTGCGG + Intronic
906700183 1:47852134-47852156 AGCCACCGCCATGGGCCCTGGGG + Intronic
908780636 1:67686279-67686301 AACCACTGCCCGGGTCCCTGGGG - Intronic
908828725 1:68158332-68158354 AAACACTGCAATGGGTACTTAGG + Intronic
913660488 1:121002565-121002587 GTCCACTGCCATGGTTCCTGTGG - Intergenic
914011851 1:143785722-143785744 GTCCACTGCCATGGTTCCTGTGG - Intergenic
914165981 1:145175412-145175434 GTCCACTGCCATGGTTCCTGTGG + Intergenic
914650479 1:149694382-149694404 GTCCACTGCCATGGTTCCTGTGG - Intergenic
915100509 1:153495709-153495731 AATACCTGCCATGGGTCCTGGGG - Intergenic
916733238 1:167584706-167584728 AACCAATCCCACTGGTCCTGTGG + Intergenic
917630725 1:176888830-176888852 AATCACTGCCATGTGACCTTGGG + Intronic
922780207 1:228246522-228246544 AAACACTGCCTTGGGCTCTGAGG - Exonic
923267539 1:232329062-232329084 GACCTCTGCCATGGTTACTGAGG - Intergenic
924867930 1:248006199-248006221 AGCCACTGCTTGGGGTCCTGTGG + Intronic
1063234885 10:4103674-4103696 AAACACTGGCAGAGGTCCTGAGG - Intergenic
1063480206 10:6368898-6368920 TAACACTTCCATGGTTCCTGGGG + Intergenic
1064313733 10:14235634-14235656 CACCACTGCCACGGGTTCAGTGG + Intronic
1066022236 10:31315607-31315629 AAGGGCTGGCATGGGTCCTGTGG + Intergenic
1067015300 10:42753675-42753697 GGCCACTGTCACGGGTCCTGTGG - Intergenic
1067534567 10:47099492-47099514 AACCACTGCGAGGGGCTCTGTGG + Intergenic
1069367507 10:67709853-67709875 GACCACTGCAATAGGTCTTGTGG - Intergenic
1074288009 10:112116483-112116505 AGCCACTGCGCTGGGTCCTGAGG + Intergenic
1075513542 10:123091727-123091749 CAACACTGACATGGCTCCTGTGG + Intergenic
1076648623 10:131971786-131971808 ACCCACAGCCAGGGCTCCTGGGG + Intronic
1081933724 11:46890198-46890220 AACCTCTACCAAGGCTCCTGGGG + Intronic
1083324245 11:61865495-61865517 TACCACTGCCACTGGGCCTGTGG - Intronic
1083787719 11:64962069-64962091 AACCACTGCCATCTGGCCAGGGG + Intronic
1083901449 11:65645447-65645469 AACACCTCCCAGGGGTCCTGGGG - Intronic
1084333331 11:68442797-68442819 AACCACTGGCCTGGGTCGTTCGG + Intronic
1084802568 11:71554822-71554844 ACCCACTGCCATGGACTCTGAGG - Intronic
1084919702 11:72459121-72459143 AGCCACTGCCATAGGAGCTGTGG + Intergenic
1089519565 11:119054926-119054948 AATCACTGCCCTAGATCCTGGGG + Intronic
1090167736 11:124569281-124569303 AACCACTGCCTTAGGACCTCAGG + Intergenic
1091281270 11:134383153-134383175 AACCCATGGGATGGGTCCTGGGG - Intronic
1093335172 12:17896410-17896432 AACTACTGCCACAGATCCTGTGG - Intergenic
1096693989 12:53337392-53337414 AACCTGGGCCATGGGCCCTGAGG + Intronic
1097342159 12:58451342-58451364 AATCACTCCCATGGGTCCCATGG - Intergenic
1097414234 12:59294843-59294865 AACCAGTGACGTGGCTCCTGAGG + Intergenic
1104618468 12:130290926-130290948 AGACACTGCCATCTGTCCTGAGG - Intergenic
1106254748 13:28012077-28012099 ACCCACTGCAATGGGCCATGGGG + Intronic
1107247293 13:38311257-38311279 CAGCTCTGCCATGGCTCCTGTGG - Intergenic
1107451841 13:40516842-40516864 AACCACTGACAAGGCTTCTGAGG + Intergenic
1107644343 13:42478531-42478553 AGGCACTGGCCTGGGTCCTGGGG + Intergenic
1107669640 13:42731581-42731603 AACCACTGCTCAGGGTCCTTAGG - Intergenic
1107822203 13:44296136-44296158 AGCCACCTCCCTGGGTCCTGAGG + Intergenic
1113298059 13:108984189-108984211 ATCCAATTCCATGGGTCCTGAGG + Intronic
1114075118 14:19157710-19157732 AACCCCTGCGCTGGGCCCTGTGG + Intergenic
1114087151 14:19242272-19242294 AACCCCTGCGCTGGGCCCTGTGG - Intergenic
1114341755 14:21752904-21752926 AAGCAGTGGCAGGGGTCCTGGGG - Intergenic
1115541248 14:34423592-34423614 AACCCCAGCCATGGCTCCCGGGG + Intronic
1117581273 14:57153904-57153926 AACCACTGCCTGGGGCCATGGGG + Intergenic
1118257421 14:64217127-64217149 ATCCATTGCCATGGTACCTGAGG + Intronic
1120542464 14:85766803-85766825 TACTACTGTCATGGTTCCTGAGG - Intergenic
1120573137 14:86146561-86146583 AAGCACTGCCTTAGGTCCTGGGG + Intergenic
1120854635 14:89201904-89201926 AAGCACTGCCATGCCTGCTGGGG - Intronic
1121657759 14:95610252-95610274 AAACATCGCCATGGTTCCTGAGG + Intergenic
1121731763 14:96192441-96192463 TACCAGTGCCATGGGTCCTTGGG - Intergenic
1122233222 14:100317622-100317644 ACCCACTGCCTGGGGTCGTGTGG + Intergenic
1122294633 14:100698299-100698321 AAACACTGCCAGGGGCCGTGGGG - Intergenic
1122882485 14:104696388-104696410 ACCCACTGCCACGTGTCCAGGGG - Intronic
1123453661 15:20394224-20394246 AACCAATGCCATGGGTATTTGGG + Intergenic
1123932491 15:25178582-25178604 AACCACTGGCCTGGGGCCAGCGG - Intergenic
1128776032 15:70321275-70321297 GACCACTGCCAAGGGCTCTGTGG + Intergenic
1129694688 15:77734073-77734095 AACCCCTGCCCTGGGCCGTGCGG + Intronic
1131415034 15:92247851-92247873 CACCACTGCCACGGCTCCTCTGG - Intergenic
1132407397 15:101552147-101552169 AATCTCTGCCATGGGACTTGGGG + Intergenic
1132633694 16:932261-932283 ATCCTCAGCGATGGGTCCTGTGG + Intronic
1134833125 16:17339740-17339762 AACCACTGCTTTAGGTGCTGGGG - Intronic
1135666588 16:24340762-24340784 AACCTCTTCCCGGGGTCCTGGGG + Intronic
1137879501 16:52031671-52031693 AACCACTGCAAGGGGACCTAAGG - Intronic
1141113442 16:81288856-81288878 AACCACTCCCTTGTGACCTGAGG - Intronic
1141896334 16:86961030-86961052 AACTGCTGCATTGGGTCCTGTGG - Intergenic
1142087001 16:88188595-88188617 CACCACTGCCAGGGATTCTGAGG + Intergenic
1142328221 16:89432372-89432394 TGCCACGGCGATGGGTCCTGAGG - Intronic
1142805457 17:2368990-2369012 ACCCACTTCCAGGGGTCCAGAGG + Intronic
1143994982 17:10998416-10998438 AACCTCTGGCATGGTTACTGGGG - Intergenic
1144087236 17:11821820-11821842 AACCACTGACCTGTGTCCTAAGG + Intronic
1145863282 17:28225361-28225383 ACCCACAGCCATCTGTCCTGGGG + Intergenic
1151829234 17:76540035-76540057 AGCCACTGCCGTCTGTCCTGCGG - Intronic
1152252424 17:79218977-79218999 CACGGCTGCCATGGCTCCTGCGG + Intronic
1152795115 17:82302798-82302820 AACCACTTCCATGGGGCTTGGGG + Intergenic
1152822332 17:82443758-82443780 AGCCAAGGCCACGGGTCCTGTGG + Exonic
1153522224 18:5963933-5963955 CCCCACTGCCATGGCTTCTGTGG - Intronic
1154064442 18:11093846-11093868 AGGCTCTGCCATAGGTCCTGAGG - Intronic
1157568206 18:48694378-48694400 CTCCACTGCCAGGGTTCCTGTGG - Intronic
1159676992 18:71297203-71297225 AAACACTACCATATGTCCTGAGG - Intergenic
1159881434 18:73861904-73861926 AACCTCAGCCATGGGTGCTTGGG - Intergenic
1160321126 18:77896727-77896749 ACCCACTGACATGGGGCCAGCGG + Intergenic
1162917910 19:13884034-13884056 TAGCACTGCCCTGGGTGCTGGGG - Intronic
1163242918 19:16075529-16075551 AACCACTGCCTTGGGCCATAGGG + Intronic
1165215701 19:34270624-34270646 AACAAATGCCATGGGTTCAGAGG - Intronic
1165479261 19:36052478-36052500 GACCACTGCCATAGGCCCTATGG + Intronic
926481635 2:13405014-13405036 AACCAATGCCATGGGTATTTGGG - Intergenic
927519251 2:23689254-23689276 AGCCACAGCCATGCCTCCTGTGG + Intronic
928393825 2:30929264-30929286 AGCCACAGCCTTGGGCCCTGCGG + Intronic
929462236 2:42111046-42111068 AACTTCTGCCAGGAGTCCTGTGG - Intergenic
929946205 2:46374475-46374497 TACCACTGCCATTTGTACTGAGG - Intronic
929980479 2:46674614-46674636 AAACACTGACATGTGACCTGTGG + Intergenic
930802713 2:55459455-55459477 ATTGACTGCCCTGGGTCCTGGGG + Intergenic
931455428 2:62406416-62406438 AATCACGGGAATGGGTCCTGTGG + Intergenic
933157600 2:78992822-78992844 AACCAGTGCCTTTGGCCCTGAGG - Intergenic
933970711 2:87467837-87467859 AAGCTCTGCAATGAGTCCTGGGG + Intergenic
936323017 2:111482345-111482367 AAGCTCTGCGATGAGTCCTGGGG - Intergenic
941030111 2:160501192-160501214 AACAATTGCCATGGTTACTGTGG + Intergenic
947984559 2:234437422-234437444 AAGCAGTGCCATGGTGCCTGTGG - Intergenic
948310187 2:236979613-236979635 AAACATTGCCAAGGGTTCTGTGG + Intergenic
948596879 2:239085186-239085208 AACGGCTGCCATGTCTCCTGGGG - Intronic
949020649 2:241739324-241739346 AAGCTTTGCCATGAGTCCTGGGG + Intronic
1171113037 20:22501639-22501661 AGCCACTGCCATGTGTCTCGTGG - Intergenic
1173359978 20:42334371-42334393 AACCACTGCCATAGGTAATTAGG + Intronic
1175082254 20:56430531-56430553 AACCATTGCAATGGTTGCTGAGG - Intronic
1175179216 20:57133419-57133441 ACCCACTGACTTGGATCCTGAGG + Intergenic
1175546832 20:59783706-59783728 AGGCACTGCCCTGGGTGCTGTGG + Intronic
1175975194 20:62707539-62707561 AACCTCTCCCAGGGGTTCTGGGG + Intergenic
1180140956 21:45893134-45893156 CACAACTGCCATAGGCCCTGAGG - Intronic
1180290767 22:10850619-10850641 AACCCCTGCGCTGGGCCCTGTGG + Intergenic
1180493568 22:15880046-15880068 AACCCCTGCGCTGGGCCCTGTGG + Intergenic
1180906856 22:19419665-19419687 AGCCACAGCTCTGGGTCCTGAGG - Intronic
1182894099 22:33844604-33844626 AACAGCTGCCATGGGGTCTGGGG + Intronic
1183189465 22:36312424-36312446 AACCACCGCGATGGATCCTTGGG - Intronic
950145691 3:10648187-10648209 AACCACTGCCATCGGATGTGTGG - Intronic
950184962 3:10939292-10939314 AGCCCCTGCCATGGGGGCTGAGG - Exonic
953494274 3:43372766-43372788 AGGCACTGTCATAGGTCCTGGGG - Intronic
954225053 3:49175929-49175951 AAACACTGCCTTGGGGCCTTGGG + Exonic
954615365 3:51966649-51966671 GACCACTCCCCTGGGTGCTGGGG + Intronic
956463913 3:69500114-69500136 AGCCACAGCTCTGGGTCCTGGGG - Intronic
957530577 3:81436137-81436159 AACCACTGCTTTGGGCCCTTAGG + Intergenic
961037524 3:123652943-123652965 AGGCACTGCCATGGGCACTGGGG - Intronic
961655327 3:128438659-128438681 CAATACTTCCATGGGTCCTGAGG - Intergenic
965239343 3:166174617-166174639 ACCCTCTGCCTTTGGTCCTGTGG - Intergenic
966582075 3:181578948-181578970 AAACTCTGGCATGGTTCCTGAGG - Intergenic
967158774 3:186717406-186717428 AACCAGTGCCCTGAGTTCTGAGG + Exonic
968505467 4:969171-969193 AACCACACCCCCGGGTCCTGGGG + Intronic
968916817 4:3500254-3500276 GTCCACAGCCACGGGTCCTGGGG - Intronic
971465984 4:26961494-26961516 AAGCACTGCATTGGATCCTGGGG + Intronic
974158214 4:58102283-58102305 AAATACTTCCTTGGGTCCTGCGG + Intergenic
976213175 4:82692239-82692261 AACCACTGCCATGGGTCCTGAGG + Intronic
976783866 4:88793864-88793886 ATCCACCGCCATAGTTCCTGTGG + Intronic
983480533 4:168268507-168268529 ACACTCAGCCATGGGTCCTGTGG - Intronic
983971544 4:173881689-173881711 AACCTTTGCCATGTGTTCTGGGG + Intergenic
986873836 5:12081732-12081754 ACCCACTGCCTAGGGCCCTGGGG + Intergenic
991603635 5:68378678-68378700 AACCACTGCCCTGGAGCTTGAGG + Intergenic
994372871 5:98987082-98987104 AACCTCTGCCATGGGTTCAAGGG + Intergenic
997470242 5:134113471-134113493 CACCGCTGCCAGGGGTCCTGTGG + Intergenic
997811912 5:136978887-136978909 AACCCCTGACGTGGGTCATGAGG - Intronic
1001280609 5:170383749-170383771 ACCCACAGGCATGGGTACTGGGG + Exonic
1002935008 6:1663963-1663985 AGGCACTGCTCTGGGTCCTGAGG - Intronic
1003317683 6:5026733-5026755 AGCCACTGCCATGTGTCCATGGG + Intergenic
1003422802 6:5973647-5973669 AGCTACTGCCATGGGCACTGTGG + Intergenic
1004522632 6:16376522-16376544 AACAGCTGACATGGGGCCTGTGG + Intronic
1005854036 6:29847281-29847303 CAGCCCTGCCAGGGGTCCTGGGG - Intergenic
1005854062 6:29847405-29847427 CAGCCCTGCCAGGGGTCCTGGGG - Intergenic
1005854088 6:29847529-29847551 CAGCCCTGCCAGGGGTCCTGGGG - Intergenic
1005854114 6:29847653-29847675 CAGCCCTGCCAGGGGTCCTGGGG - Intergenic
1007510187 6:42368646-42368668 AACTACTGCCTGGAGTCCTGGGG - Intronic
1007612450 6:43159317-43159339 AAGCTCTGGCATGGGTGCTGAGG - Intronic
1018033000 6:159858493-159858515 AAGCACTGCCCAGGGACCTGAGG - Intergenic
1018230042 6:161666500-161666522 GACCACTGCCATAGGACCTTTGG + Intronic
1021766703 7:23956959-23956981 AACCCCTGGCCTGGGTGCTGTGG - Intergenic
1022046581 7:26626856-26626878 AAAAACAGCCCTGGGTCCTGTGG + Intergenic
1022628244 7:32060392-32060414 AATCAGTGCCATGGCTCCTTGGG + Intronic
1024544420 7:50505452-50505474 TAGCAATGCCATGTGTCCTGAGG + Intronic
1028098755 7:86794712-86794734 AACCCCTAGCATGGTTCCTGGGG + Intronic
1028512105 7:91636560-91636582 AACCACAGCCATGGTGTCTGAGG + Intergenic
1028520178 7:91721222-91721244 ACACACTGCCAAGGGGCCTGAGG + Intronic
1031450070 7:121905180-121905202 AATCACTGCTATTGGTCCTTGGG + Intronic
1033754672 7:144388506-144388528 AAACAGGGCCATAGGTCCTGGGG - Intergenic
1034164613 7:149015839-149015861 GACCACACCCAGGGGTCCTGAGG + Intronic
1034201762 7:149287157-149287179 AACACCTGCCAGGGGACCTGGGG - Intronic
1034527579 7:151675493-151675515 AACCTCTGCCCTGTGTCCGGGGG + Exonic
1035024350 7:155816267-155816289 ACCCACAGTCATGGGGCCTGTGG - Intergenic
1035731126 8:1854154-1854176 AGACACTGCCCTGGGCCCTGGGG - Intronic
1037200750 8:16249666-16249688 AACAACTGCCACCGGGCCTGAGG - Intronic
1037730440 8:21519288-21519310 CATCACTGCCATGGGTCTTCTGG - Intergenic
1039179903 8:34854822-34854844 AACCAATGACATGGGTCCTAAGG - Intergenic
1039906190 8:41787938-41787960 AACCTCTGCCAGGGGTACTGGGG - Intronic
1040594012 8:48820315-48820337 AAGCACTGCCTAGAGTCCTGGGG - Intergenic
1044339259 8:91028129-91028151 AGCCACTGCCAAAAGTCCTGTGG - Intronic
1044434595 8:92147280-92147302 AGCCACTGTCCTGGGTCTTGGGG + Intergenic
1049564747 8:143332173-143332195 CAGCACTGCGCTGGGTCCTGCGG + Intronic
1050648279 9:7746022-7746044 CACCACCCCAATGGGTCCTGGGG + Intergenic
1052144894 9:25036754-25036776 AACTTCTGCCATGGAGCCTGAGG - Intergenic
1052248695 9:26370590-26370612 ATACACTGCCCTGGGTGCTGGGG + Intergenic
1061866334 9:133493488-133493510 AGCCACTGCCATGCAGCCTGGGG - Intergenic
1062390523 9:136331942-136331964 CACCATGGCCACGGGTCCTGGGG - Intronic
1186253497 X:7694517-7694539 AAATAATGCCATGGGCCCTGGGG - Intergenic
1188550528 X:31359697-31359719 AGGCACTGACCTGGGTCCTGGGG - Intronic
1192181131 X:68916470-68916492 AGCCCCTGCACTGGGTCCTGGGG - Intergenic
1192368899 X:70497496-70497518 AATCCCTGCCATGGGTACTGTGG + Intronic
1196212899 X:113015063-113015085 CACCACTTCCATGGCTCTTGTGG + Intergenic
1196695229 X:118604186-118604208 AACCACTGCCATAGGCTATGGGG + Intronic
1200165620 X:154033255-154033277 AACTACCGCCTAGGGTCCTGGGG + Intronic
1200979116 Y:9245474-9245496 AACAACTGTAATGGGTCCTCTGG + Intergenic