ID: 976214732

View in Genome Browser
Species Human (GRCh38)
Location 4:82705313-82705335
Sequence AAATATCCTCAGAGGCAGCT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 168}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976214723_976214732 20 Left 976214723 4:82705270-82705292 CCTCCATCCTCACCTGGAAAGCC 0: 1
1: 0
2: 1
3: 28
4: 309
Right 976214732 4:82705313-82705335 AAATATCCTCAGAGGCAGCTTGG 0: 1
1: 0
2: 1
3: 22
4: 168
976214724_976214732 17 Left 976214724 4:82705273-82705295 CCATCCTCACCTGGAAAGCCATG 0: 1
1: 0
2: 0
3: 22
4: 253
Right 976214732 4:82705313-82705335 AAATATCCTCAGAGGCAGCTTGG 0: 1
1: 0
2: 1
3: 22
4: 168
976214729_976214732 -1 Left 976214729 4:82705291-82705313 CCATGGAGTTGGCGACAGCCAGA 0: 1
1: 0
2: 0
3: 11
4: 123
Right 976214732 4:82705313-82705335 AAATATCCTCAGAGGCAGCTTGG 0: 1
1: 0
2: 1
3: 22
4: 168
976214722_976214732 21 Left 976214722 4:82705269-82705291 CCCTCCATCCTCACCTGGAAAGC 0: 1
1: 0
2: 1
3: 29
4: 259
Right 976214732 4:82705313-82705335 AAATATCCTCAGAGGCAGCTTGG 0: 1
1: 0
2: 1
3: 22
4: 168
976214726_976214732 13 Left 976214726 4:82705277-82705299 CCTCACCTGGAAAGCCATGGAGT 0: 1
1: 0
2: 1
3: 15
4: 220
Right 976214732 4:82705313-82705335 AAATATCCTCAGAGGCAGCTTGG 0: 1
1: 0
2: 1
3: 22
4: 168
976214728_976214732 8 Left 976214728 4:82705282-82705304 CCTGGAAAGCCATGGAGTTGGCG 0: 1
1: 0
2: 1
3: 12
4: 159
Right 976214732 4:82705313-82705335 AAATATCCTCAGAGGCAGCTTGG 0: 1
1: 0
2: 1
3: 22
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976214732 Original CRISPR AAATATCCTCAGAGGCAGCT TGG Exonic
901429934 1:9207628-9207650 AAATATCCCAAGAGCCAGATTGG - Intergenic
905054166 1:35078895-35078917 AATTATCCTCAGAGGTAGGGAGG - Intronic
905279851 1:36842096-36842118 ACATGTCCTGAGAGCCAGCTGGG + Intronic
907121474 1:52011740-52011762 AAATATCCTGATAGGCAGCTGGG + Intergenic
909748460 1:79128630-79128652 CAATATCCTCAAAGACAACTTGG - Intergenic
914045535 1:144088767-144088789 AAATATACACAGAGGTAGTTAGG + Intergenic
914132575 1:144871919-144871941 AAATATACACAGAGGTAGTTAGG - Intergenic
915987814 1:160483733-160483755 AAAGAGCCTGAGAAGCAGCTAGG + Intergenic
921124913 1:212168866-212168888 AAATATCCTCAGGTGAGGCTGGG - Intergenic
922075825 1:222243545-222243567 AAATATCCTCAGGGGCCTCCAGG + Intergenic
1063636713 10:7788826-7788848 AACCACCCTCAGAGGCATCTAGG - Intronic
1065523236 10:26592461-26592483 AAATTTCCGAACAGGCAGCTTGG - Intergenic
1066999312 10:42592055-42592077 TATTATCCTTAGAGGAAGCTTGG + Exonic
1069086197 10:64142318-64142340 AAACAACCTCAGAGGCAGTTTGG - Intergenic
1070225671 10:74502689-74502711 AACTATTCTCAGAGGCATCTAGG + Intronic
1070527849 10:77310603-77310625 AAGGCTGCTCAGAGGCAGCTGGG - Intronic
1071530382 10:86386773-86386795 AAATATTATCAGTGTCAGCTGGG + Intergenic
1072339478 10:94432907-94432929 AAATATCCTTATAAGTAGCTGGG + Intronic
1075222506 10:120597367-120597389 AGTGATCCTCAGAGGTAGCTGGG - Intergenic
1076443797 10:130498193-130498215 AATTATCCCCAGAGCCAGCACGG - Intergenic
1076472705 10:130729889-130729911 AGAGATGCTCAGAGGCAGGTTGG - Intergenic
1084860307 11:72013812-72013834 AAATAGCCTCATCAGCAGCTTGG - Exonic
1088099268 11:106136729-106136751 AAAGAACCTCAGATGCAACTAGG - Intergenic
1088630255 11:111767173-111767195 AAGAGTCCTCAGAGGCAGCAAGG + Intergenic
1093164622 12:15790064-15790086 AAATAGGCTCACAGGCAGCCTGG - Intronic
1096057331 12:48664983-48665005 AAAAATCCTCCCAGGTAGCTAGG + Intronic
1098963250 12:76761249-76761271 AAATATCCACAGAGCCAGGCAGG + Intergenic
1099178519 12:79451733-79451755 AAATATACACAAAGGCAACTAGG - Exonic
1103978602 12:124720843-124720865 AGATGTCCTCAGAGGCCCCTGGG - Intergenic
1104563568 12:129860158-129860180 AAATGTCCACAGAGGCAGAGTGG - Intronic
1106227429 13:27795538-27795560 ATATGTCCTCAAAGGGAGCTGGG - Intergenic
1108865162 13:54914163-54914185 AAAGATTTTCAGAGACAGCTTGG + Intergenic
1110343683 13:74421353-74421375 AAATATCCTGAGAGGCAGAGAGG + Intergenic
1112841396 13:103583235-103583257 AAATATCATCAGAGGCAAACTGG - Intergenic
1115098957 14:29674792-29674814 AAATATTCTGATAGGCAGCAGGG + Intronic
1115437070 14:33387266-33387288 ACACTTCCACAGAGGCAGCTTGG + Intronic
1117054523 14:51898181-51898203 TATTAGCCTCAAAGGCAGCTTGG - Intronic
1120287140 14:82518242-82518264 AAATATCCTGAGAGACAAATAGG + Intergenic
1120869039 14:89320905-89320927 AAAACTCCTCAGAGTCAGCTGGG - Intronic
1126251466 15:46572758-46572780 ACATAATATCAGAGGCAGCTTGG - Intergenic
1126757358 15:51937565-51937587 AAGAATCTTCAGAGGCAGCATGG + Intronic
1127151977 15:56085164-56085186 AAATATGCTCAGATATAGCTTGG + Intergenic
1130013912 15:80173181-80173203 AAGCAGCCTCAGAGGCAGCAGGG - Intronic
1130715717 15:86331528-86331550 AAAAAACCTTAAAGGCAGCTAGG + Intronic
1130943026 15:88526923-88526945 AAGTATTTTCAGAGGCACCTGGG + Intronic
1137543723 16:49383165-49383187 AAAGGTGCTCAGAGGCATCTAGG + Intronic
1138166981 16:54811788-54811810 AAGTATCCTACGAGGCAGATTGG + Intergenic
1138574318 16:57897780-57897802 AAATAAGGTCAGACGCAGCTGGG - Exonic
1141021788 16:80503706-80503728 AAATATCCTTAGGGTCAGCCTGG - Intergenic
1141097741 16:81174930-81174952 AAATATGCTCAGAACCTGCTAGG + Intergenic
1147139005 17:38451225-38451247 AAGTCCCCACAGAGGCAGCTGGG + Intronic
1149554715 17:57565163-57565185 AAAAATCCTTAGATGCAGATGGG - Intronic
1150663920 17:67112388-67112410 ACATATAGTCAGAGGCAGCTTGG - Intronic
1150921952 17:69493463-69493485 AAAAATACTCAGCTGCAGCTGGG + Intronic
1152254065 17:79227276-79227298 GAACATCCACAGAGGCAGGTTGG + Intronic
1155333562 18:24742255-24742277 AAACATCTTCAGAGCCATCTGGG + Intergenic
1157323317 18:46650602-46650624 AAATATCCTCCTAATCAGCTGGG - Intronic
1157443937 18:47730914-47730936 AAATAGCCTCAGAGACACCAAGG - Intergenic
1158764617 18:60434610-60434632 AAATATCCTCACAAGAAGATGGG + Intergenic
1159630626 18:70745649-70745671 CAATATCCTGAGTGGCAGATGGG + Intergenic
1161153903 19:2722516-2722538 AAGTCTCCGCAGAGGCAGATGGG - Intronic
1166632479 19:44419228-44419250 AAATAGCCTCAGGTGCAGCCTGG - Intronic
1202685094 1_KI270712v1_random:42174-42196 AAATATACACAGAGGTAGTTAGG + Intergenic
925574017 2:5341435-5341457 AAATATCCTCATAAGAAGATGGG + Intergenic
928581613 2:32713557-32713579 AAATATCTTCAGAGGCACAACGG - Intronic
928960583 2:36922051-36922073 AAATATACACAGAGGTAGTTAGG + Intronic
929568598 2:43006011-43006033 AGAAATCCGAAGAGGCAGCTAGG - Intergenic
929619231 2:43337449-43337471 AAATCTCCTCATACGAAGCTTGG + Intronic
933663277 2:84944737-84944759 ACATATGCTCAGAGACAGCCAGG - Intergenic
934246625 2:90312682-90312704 AAATATACACAGAGGTAGTTAGG - Intergenic
936467107 2:112763752-112763774 ATCTATCCTTAGAGACAGCTTGG + Intronic
938067415 2:128288766-128288788 AGATGTCCTGAGAGGCTGCTGGG - Intronic
938278426 2:130048537-130048559 TCATATCCTAAGAGGCAGCCAGG + Intergenic
938329402 2:130439396-130439418 TCATATCCTAAGAGGCAGCCAGG + Intergenic
938360546 2:130682107-130682129 TCATATCCTAAGAGGCAGCCAGG - Intergenic
938436949 2:131288815-131288837 TCATATCCTAAGAGGCAGCCAGG - Intronic
943813705 2:192223752-192223774 AAATATGCTTAGAGGCAGCGTGG + Intergenic
944656400 2:201880576-201880598 ATATGTCCTGAGAGGGAGCTGGG + Intronic
944890097 2:204108723-204108745 AAAAATCAGCAGTGGCAGCTGGG - Intergenic
945268723 2:207917219-207917241 AAATTTCATCAGCTGCAGCTGGG - Intronic
946718601 2:222579832-222579854 AAATCTCCTCAGAGTAAACTTGG - Intronic
946933004 2:224690136-224690158 AAATATCCTGAAAGGAAACTGGG - Intergenic
1168898187 20:1338277-1338299 AAATATCCACCATGGCAGCTAGG + Intronic
1173550510 20:43930001-43930023 AAAAATACTCAGAAGCAGCTGGG - Intronic
1177105196 21:16946332-16946354 AAATATCCCAAGAGCCTGCTTGG - Intergenic
1177863513 21:26484106-26484128 AAATATTCCCAGGGGCAGCTAGG + Intronic
1179272717 21:39863954-39863976 AAATAATCTCAAAGACAGCTTGG + Intergenic
1181846400 22:25712708-25712730 ATTTATCCTCAGAGAAAGCTTGG - Intronic
1182078222 22:27509743-27509765 ACATTCCCTCAAAGGCAGCTGGG + Intergenic
1182126756 22:27821536-27821558 AAGATTCCTCAGAGCCAGCTTGG + Intergenic
1184484863 22:44770915-44770937 AAACTTCCCCAGAGTCAGCTTGG + Intronic
1184604214 22:45562953-45562975 GGTTATTCTCAGAGGCAGCTTGG - Intronic
949582573 3:5404588-5404610 AATTATGCCCAGAGGCAACTGGG + Intergenic
949625595 3:5863193-5863215 CAATATCCTCAGGGGCACCAAGG - Intergenic
950218643 3:11177926-11177948 AAATCTCTTCAGAGGGAGGTGGG - Intronic
953250479 3:41242151-41242173 AAATATCCACAGATGGAGCAAGG + Intronic
956553235 3:70485841-70485863 AGATATACTCAGAGCCAACTTGG + Intergenic
957511758 3:81198271-81198293 AAATATCCACAAAGGGAGCTTGG + Intergenic
958057797 3:88435210-88435232 AGGTATCCCCAGAGGCACCTGGG - Intergenic
960423007 3:117471710-117471732 AAATTTCTTCAGATGCTGCTGGG - Intergenic
962226247 3:133612449-133612471 ATTTAGCCTCAGTGGCAGCTGGG - Exonic
964341991 3:155717596-155717618 AAAGAGCCTCAGATACAGCTTGG - Intronic
965644319 3:170864182-170864204 TAATATCCACATTGGCAGCTAGG - Intergenic
965885448 3:173440362-173440384 AAATGTTCTCAGTGGCACCTAGG + Intronic
968757735 4:2425708-2425730 AACTATCCTCAGAGGAGGCGGGG - Intronic
971400017 4:26267374-26267396 AAATATACTCAGAGGAACCCAGG - Intronic
973958881 4:56090015-56090037 AAATATTCTGAGGGGCATCTAGG + Intergenic
974906347 4:68063188-68063210 AAGTATCTCCAGAGGCAGTTGGG - Intronic
976214732 4:82705313-82705335 AAATATCCTCAGAGGCAGCTTGG + Exonic
977691618 4:99918129-99918151 ACATAGCCTCAGAGACAGGTGGG - Intronic
978337241 4:107682642-107682664 ATATATCTTCACAGGCAGCTTGG - Intronic
980734242 4:136863911-136863933 AAATAGCCACAGAGGGAGCTTGG + Intergenic
981959884 4:150523742-150523764 GACTATCCTCAGAGGGAGGTGGG + Intronic
982877919 4:160671195-160671217 AAATGTCCAAAGAGGCAGCGGGG - Intergenic
987105354 5:14633480-14633502 AAAAATCGTCATAGGCAACTGGG + Intergenic
990052764 5:51528297-51528319 TAATTTCATCAAAGGCAGCTGGG + Intergenic
994856396 5:105126651-105126673 AACTCTCGTAAGAGGCAGCTGGG - Intergenic
995208943 5:109515127-109515149 AAATGTCTTCAGAGGGAGATTGG - Intergenic
996705173 5:126490664-126490686 ACCTTTCCTCAGAGGCAGCTGGG + Intronic
997845473 5:137282250-137282272 AAATCTCCTCAGAGTCAGAATGG - Intronic
998537107 5:142943644-142943666 AAATATCCTTAAAGGTAGGTGGG - Intronic
1000705016 5:164500477-164500499 AAATATGTACATAGGCAGCTGGG - Intergenic
1002053842 5:176587150-176587172 AATAATTCTCAGAGCCAGCTGGG + Intronic
1002993828 6:2264201-2264223 AAGTATCCTGAGAGAGAGCTAGG + Intergenic
1006730226 6:36230819-36230841 AAATATCCCCTGAGGGACCTTGG - Exonic
1007729997 6:43939836-43939858 AAATTTCCTCAGAGGGGGCAGGG - Intergenic
1009192787 6:60649862-60649884 AAAAGTCCTAAGAGGGAGCTGGG - Intergenic
1010988791 6:82456188-82456210 AAATATCCTCAGAGACTATTAGG - Intergenic
1011471664 6:87714025-87714047 AAATATAATCAGAGGCAGGCCGG - Intergenic
1013728075 6:113125959-113125981 TTATATTCTCACAGGCAGCTTGG - Intergenic
1014960524 6:127678323-127678345 AAAATCCCTCAGAGGCAACTAGG - Intergenic
1015175241 6:130299805-130299827 AAAGATCCTCAGAGACTACTAGG + Intronic
1015741578 6:136460784-136460806 AAAAATCTTCAGATGCACCTTGG - Intronic
1016868374 6:148792031-148792053 TAAAATCCTCAGAGGAAGCGGGG + Intronic
1020680262 7:11228035-11228057 AAATTTGCTCCAAGGCAGCTGGG - Intergenic
1021252868 7:18353492-18353514 AACTATCCTCAGAGGCACAGAGG - Intronic
1022671422 7:32459803-32459825 GAATATCCAAAGATGCAGCTGGG + Intergenic
1022897638 7:34768216-34768238 ACATATCTTCAAAGCCAGCTGGG + Intronic
1024634770 7:51277897-51277919 CTAGTTCCTCAGAGGCAGCTTGG - Intronic
1026371122 7:69700536-69700558 GAAAATCCCCAGAGGCAGCCAGG - Intronic
1026557576 7:71421591-71421613 CCATATCCCGAGAGGCAGCTGGG - Intronic
1027340041 7:77197375-77197397 AAATATCCTCACATGCAGACTGG - Intronic
1028532720 7:91855645-91855667 AAAGATCCTCAGAGACGTCTAGG + Intronic
1028717666 7:93991593-93991615 AAATATACTCATAGGCTGATAGG - Intronic
1028739505 7:94257498-94257520 AAAAATCCACTCAGGCAGCTTGG - Intergenic
1030434901 7:109505053-109505075 AAATATCATCAGAGTAAGCCTGG - Intergenic
1031212248 7:118845454-118845476 AAATATCCTAAGACAGAGCTAGG + Intergenic
1031660713 7:124420854-124420876 AAAAACCCTCAGAGTGAGCTGGG - Intergenic
1031741426 7:125436470-125436492 AAGTATGCACAGAGGAAGCTGGG + Intergenic
1032921122 7:136549383-136549405 AAGAATCCTCAGAGGCAGATAGG - Intergenic
1034033260 7:147791174-147791196 AAATGTCATCAGAGGCATCTAGG - Intronic
1034753072 7:153588776-153588798 AATTATCCGGGGAGGCAGCTTGG + Intergenic
1034890382 7:154834141-154834163 AATATTCCTCAGTGGCAGCTGGG - Intronic
1038287928 8:26222671-26222693 AAAAATCCTCAGAGGAGGCTGGG + Intergenic
1042419209 8:68565426-68565448 GCATATCCTCAGAGACAGCTGGG - Intronic
1044048984 8:87475790-87475812 AAATACCCTCAGAACCAGGTGGG + Intronic
1044118906 8:88368964-88368986 AAATATCCTCAGAGACTGTTAGG - Intergenic
1044776601 8:95695442-95695464 AAATATCTTCAGAGAAGGCTGGG + Intergenic
1045368464 8:101497598-101497620 AAATATCATCTGAGGCACCCTGG + Intronic
1046688375 8:117253595-117253617 AAAGTTCCTCAGAGACAGTTAGG + Intergenic
1051088563 9:13380158-13380180 TAATTTCCTCAAAGGCAGCTGGG - Intergenic
1054990470 9:71319781-71319803 AATGATCCTCAGGGTCAGCTAGG + Intronic
1055663303 9:78528868-78528890 ACATATCCTAAGAGTCAGCTGGG - Intergenic
1057182727 9:93038506-93038528 AATTCTCCTCTCAGGCAGCTGGG - Intergenic
1057186983 9:93062533-93062555 AGACATCCTCAAAGACAGCTGGG + Intronic
1057857978 9:98616794-98616816 AGAGATCCACAGAGTCAGCTGGG + Intronic
1058797784 9:108515382-108515404 AAATATTTTCAGAAGCAGCAGGG + Intergenic
1059295507 9:113266573-113266595 AAAGAACCAGAGAGGCAGCTCGG - Intronic
1185924890 X:4134653-4134675 AGACAACCTCAGAGGCAACTCGG - Intergenic
1186314500 X:8354489-8354511 AAATATCCTGAAAGTCAGCCAGG - Intergenic
1187109803 X:16285329-16285351 AAAAATCCACAGAGACAGCTCGG + Intergenic
1187387659 X:18863004-18863026 AAAAATCTTTAGAGTCAGCTGGG - Intergenic
1191689618 X:63926391-63926413 AACCATACTCAGAAGCAGCTAGG - Intergenic
1192899480 X:75480731-75480753 AATTTTCCTCAGAGACAGCCTGG - Intronic
1193409352 X:81143932-81143954 AAATATCTAGAGAGGCAGCCTGG - Intronic
1193800229 X:85926319-85926341 AAATCTTCTCAGAGGCTGTTTGG + Intronic
1194184046 X:90749905-90749927 AAAGATCCTCAGAGACTGCTAGG + Intergenic
1194974269 X:100377796-100377818 AAAAATCCTGAGAGGCAGTGAGG + Intronic
1195066532 X:101242824-101242846 AAAGATTCCCAGAGGCACCTGGG + Intronic
1195397983 X:104431682-104431704 AGATTGCCTCAGAGCCAGCTAGG + Intergenic
1195515385 X:105768951-105768973 AATGATCCTCACAGGCATCTAGG - Intergenic
1198062005 X:133055511-133055533 AAATTCCCTCAGTGGAAGCTTGG - Intronic
1198804996 X:140485325-140485347 AAAAATTCTAAGTGGCAGCTGGG + Intergenic
1199753444 X:150843100-150843122 TAATAACTGCAGAGGCAGCTGGG + Intronic
1200530641 Y:4331837-4331859 AAAGATCCTCAGAGACTGCTAGG + Intergenic
1201782737 Y:17741374-17741396 AAAGGTCCTCAGGGGCAACTGGG - Intergenic
1201818816 Y:18164614-18164636 AAAGGTCCTCAGGGGCAACTGGG + Intergenic
1202174086 Y:22081542-22081564 AAAGTTCCTGAGGGGCAGCTGGG - Intronic
1202217274 Y:22504840-22504862 AAAGTTCCTGAGGGGCAGCTGGG + Intronic
1202325912 Y:23691219-23691241 AAAGTTCCTGAGGGGCAGCTGGG - Intergenic
1202544859 Y:25978835-25978857 AAAGTTCCTGAGGGGCAGCTGGG + Intergenic
1202588509 Y:26457277-26457299 AAATATACACAGAGGTAGTTAGG - Intergenic