ID: 976217971

View in Genome Browser
Species Human (GRCh38)
Location 4:82732528-82732550
Sequence CAGGATCTGATGTGATGGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 188}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976217971_976217977 6 Left 976217971 4:82732528-82732550 CCTACCCATCACATCAGATCCTG 0: 1
1: 0
2: 1
3: 14
4: 188
Right 976217977 4:82732557-82732579 GCAGGCGTCCTGTCCAAGGTTGG 0: 1
1: 0
2: 0
3: 11
4: 106
976217971_976217976 2 Left 976217971 4:82732528-82732550 CCTACCCATCACATCAGATCCTG 0: 1
1: 0
2: 1
3: 14
4: 188
Right 976217976 4:82732553-82732575 GAAAGCAGGCGTCCTGTCCAAGG 0: 1
1: 0
2: 0
3: 15
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976217971 Original CRISPR CAGGATCTGATGTGATGGGT AGG (reversed) Intronic
905938094 1:41840711-41840733 CAGGATCTGATGGGCTCCGTGGG - Intronic
907334871 1:53693499-53693521 CAGGATGGGATGTGGTGGCTGGG - Intronic
907440024 1:54473230-54473252 CAGGCTGTGATGTTAGGGGTGGG + Intergenic
907985441 1:59525104-59525126 CTGGATCTGATGTGCTGCATGGG - Intronic
908423820 1:63985529-63985551 CCTGACCTCATGTGATGGGTTGG + Intronic
908475347 1:64482377-64482399 CAGGATGTGCTGAAATGGGTTGG + Intronic
909368353 1:74855758-74855780 CAAGATCTGATTTGATTGCTTGG - Intergenic
910669543 1:89759273-89759295 GAGGATCTCATGTGAAGGGCTGG + Intronic
910878689 1:91902908-91902930 GAGGATCTCATGAGATGGGCAGG + Intronic
911210401 1:95132869-95132891 CAGGATCTGATGTTGTGGAGAGG + Intronic
913406617 1:118500966-118500988 CAGGTTCTTATGTGATGGCCAGG - Intergenic
914205000 1:145519068-145519090 CAGGAGCTGATGGGGTGGGAGGG - Intergenic
914484119 1:148092250-148092272 CAGGAGCTGATGGGGTGGGAGGG - Intergenic
917741347 1:177964500-177964522 CAGGCCCTGATGAGAAGGGTTGG + Intronic
919405494 1:197176921-197176943 TAGGATCTAATATGATGGGAAGG - Intronic
919731423 1:200915926-200915948 GGGGAGCTGGTGTGATGGGTTGG + Intergenic
920649271 1:207824617-207824639 AAGGATCTCATGTGTGGGGTAGG - Intergenic
923518926 1:234721077-234721099 CAGAATCGGATGAGATGGGGTGG + Intergenic
1062993090 10:1838360-1838382 CCGGCTATTATGTGATGGGTTGG + Intergenic
1070899826 10:80018733-80018755 CAGGATTTGGAGAGATGGGTGGG - Intergenic
1071930179 10:90460769-90460791 CAGGATATGATCTGAGAGGTTGG + Intergenic
1072593537 10:96849607-96849629 CTCGACCTTATGTGATGGGTTGG + Intronic
1072661495 10:97366373-97366395 CAGGTTCTCAGGTGGTGGGTAGG - Intronic
1073224697 10:101907986-101908008 GAAGATCAGATATGATGGGTTGG - Intronic
1074291627 10:112141993-112142015 AGTGATGTGATGTGATGGGTGGG + Intergenic
1074682582 10:115923411-115923433 CAGGGCCTGTTGTGAGGGGTTGG - Intronic
1074904441 10:117848798-117848820 CAGGGTCTGATGTGGTGGGGGGG + Intergenic
1075429030 10:122365175-122365197 CAGCATCTGATGTGAAGCCTAGG + Intergenic
1075429057 10:122365339-122365361 CAGCATCTGATGTGAAGCCTAGG + Intergenic
1077093691 11:790588-790610 AAGGTTCTGATGTGACGGGAGGG + Exonic
1078132299 11:8622767-8622789 CAGGACGTGAAGTCATGGGTGGG + Intronic
1078467399 11:11560307-11560329 CAGGATATGATAGGATGGGGTGG + Intronic
1078944600 11:16049881-16049903 CAGGCTCTGCTGTCTTGGGTCGG + Exonic
1079247073 11:18760518-18760540 CAGGATCTAAGGTGAAGAGTAGG + Intronic
1080032036 11:27671812-27671834 CAGGATCTGATTGAGTGGGTGGG - Intronic
1080414692 11:32058271-32058293 CAAGTTTTGATGTGAAGGGTGGG - Intronic
1081101789 11:39011036-39011058 CAGGATGTGGTGAAATGGGTGGG - Intergenic
1081590547 11:44419872-44419894 CTGGATCTGATGTGATGCCATGG + Intergenic
1082269564 11:50155268-50155290 CAGGAGCTGAGGGGATGGGGAGG - Intergenic
1085652884 11:78284462-78284484 CAGGAGCTGAGGTGAGGGGTGGG - Intronic
1087359824 11:97144101-97144123 CAGGTTCTGAGGTGATGTTTTGG + Intergenic
1089099699 11:115952327-115952349 CAGGAGCTGATGTGATGCTGGGG + Intergenic
1089673030 11:120069608-120069630 CAGACTCTGCTCTGATGGGTGGG - Intergenic
1090458821 11:126871814-126871836 CAGGACCTGATGAAATGTGTTGG - Intronic
1090660044 11:128875670-128875692 CAGGATCTGCTGTGCTGGGGAGG + Intergenic
1090885610 11:130873653-130873675 TAGGTTCTGATGTAGTGGGTTGG - Intergenic
1092711986 12:11348657-11348679 CATGATGTGATGTGATGTGATGG + Intergenic
1092884078 12:12910507-12910529 AAGGATTTGATGGGATGGGGTGG - Intronic
1100196182 12:92248170-92248192 CATGATCTGATGAGATGAGTAGG + Intergenic
1103044386 12:117723348-117723370 TGGGAACTGTTGTGATGGGTTGG - Intronic
1103727964 12:123008231-123008253 CAGGATCTCAGCTGCTGGGTAGG + Intronic
1106231241 13:27822780-27822802 CTGCAGCTGATTTGATGGGTTGG + Intergenic
1107070851 13:36266840-36266862 CAGGATCTGTTCTGATTGGTAGG - Intronic
1107713256 13:43171634-43171656 CAGGATCTGAAGTAAGGGCTTGG + Intergenic
1108276112 13:48811493-48811515 CCAGATATGATGTGATGGGAAGG - Intergenic
1108862177 13:54874787-54874809 CAGGATCTCATGGGATGGTTGGG + Intergenic
1110888167 13:80664916-80664938 TAGGATCTGATATGCAGGGTGGG + Intergenic
1110928409 13:81184900-81184922 CAGGAACTGATGGGTGGGGTGGG - Intergenic
1112155782 13:96815603-96815625 AATGATCTGCTATGATGGGTGGG - Intronic
1115705027 14:35989846-35989868 CAGGTTCTGATTTGATGTCTGGG - Intergenic
1119939411 14:78624713-78624735 CTGGGTCTGAGGTGATGGGGTGG + Intronic
1121600032 14:95196416-95196438 CAGTTTCTGATTTGATGGGGTGG - Intronic
1122776610 14:104119681-104119703 CTGGAGCTGATGTGGTGGGAGGG + Intergenic
1124411334 15:29439925-29439947 CATGATATGATGTGATGAGGGGG + Intronic
1128666574 15:69542553-69542575 CAGTTTCTGATGGGATGGCTGGG + Intergenic
1130557433 15:84932523-84932545 CAGGACTGGATGTGATGGGTTGG + Intronic
1131273287 15:90959815-90959837 CAGGAGCGGATGCGATGGGGAGG + Intronic
1134167570 16:11942706-11942728 CAGCATCATGTGTGATGGGTGGG + Intronic
1134309370 16:13061794-13061816 CGGGATACGAAGTGATGGGTTGG + Intronic
1134525064 16:14936760-14936782 CAGCATCATGTGTGATGGGTGGG - Intronic
1134582064 16:15378955-15378977 CAGCATCATGTGTGATGGGTGGG + Intronic
1134712654 16:16335247-16335269 CAGCATCATGTGTGATGGGTGGG - Intergenic
1134954173 16:18373446-18373468 CAGCATCATGTGTGATGGGTGGG + Intergenic
1135312997 16:21420358-21420380 CAGCATCATGTGTGATGGGTGGG + Intronic
1135365921 16:21852638-21852660 CAGCATCATGTGTGATGGGTGGG + Intronic
1135445894 16:22518524-22518546 CAGCATCATGTGTGATGGGTGGG - Intronic
1136152155 16:28358090-28358112 CAGCATCATGTGTGATGGGTGGG + Intronic
1136194593 16:28643093-28643115 CAGCATCATGTGTGATGGGTGGG - Intronic
1136210925 16:28757192-28757214 CAGCATCATGTGTGATGGGTGGG - Intronic
1136255647 16:29037151-29037173 CAGCATCATGTGTGATGGGTGGG - Intergenic
1136309667 16:29399086-29399108 CAGCATCATGTGTGATGGGTGGG + Intronic
1136323110 16:29500866-29500888 CAGCATCATGTGTGATGGGTGGG + Intronic
1136437794 16:30240834-30240856 CAGCATCATGTGTGATGGGTGGG + Intronic
1138200725 16:55086389-55086411 CAGGGTCAGATGTGGTGGCTTGG + Intergenic
1138619332 16:58198471-58198493 CAGTATGGGATGTGTTGGGTGGG - Intergenic
1139857349 16:69991465-69991487 CAGCATCATGTGTGATGGGTGGG + Intergenic
1140365324 16:74376455-74376477 CAGCATCATGTGTGATGGGTGGG - Intergenic
1140507914 16:75485963-75485985 CAGGATCAGATGTGTGGTGTAGG - Intronic
1144215788 17:13053994-13054016 CAGGAACGAATGTGCTGGGTGGG + Intergenic
1146506546 17:33410574-33410596 CCTGATCTGATGGGATGGGCTGG - Intronic
1146702602 17:34974314-34974336 CAAGAGCTGATTTTATGGGTTGG - Intronic
1148528082 17:48361887-48361909 CAGAAGCTGGTGGGATGGGTAGG - Intronic
1148743524 17:49906278-49906300 AAGAATCTGATGTGATGGTGAGG + Intergenic
1149784593 17:59424298-59424320 GAAGATCTGGTGTGTTGGGTAGG + Intergenic
1150354384 17:64470690-64470712 CAGGATCTGATCGAAAGGGTGGG - Intergenic
1151814892 17:76466951-76466973 CAGGATCTGCACTGCTGGGTGGG + Intronic
1152466579 17:80469962-80469984 CAGGATCTGAGGAGGTGGGAAGG + Exonic
1153071230 18:1106852-1106874 CAGGATGGGATGGGATGGGGTGG - Intergenic
1154118796 18:11634713-11634735 CAGCATCATGTGTGATGGGTGGG + Intergenic
1155033325 18:22002875-22002897 CAGGCAGTGGTGTGATGGGTGGG + Intergenic
1156466876 18:37353392-37353414 AAGGGTCTGAGGTGATGGCTTGG + Intronic
1156586339 18:38435056-38435078 CAGGATCTGCTGCAATGGGTTGG - Intergenic
1157204830 18:45689096-45689118 CAGGTTGTGGTGTGATGTGTTGG - Intergenic
1158209199 18:55027135-55027157 CAGAATCTGAACTGATAGGTTGG + Intergenic
927215900 2:20667651-20667673 CAGGACCTGACGGGATGGGCGGG - Intronic
928288019 2:30010211-30010233 CAGGCTGTGAGGTGAGGGGTGGG + Intergenic
929484685 2:42342884-42342906 CAGGATGTGTTGGGATGGGCAGG - Intronic
929785549 2:44988264-44988286 CAGGATCAGGAGTGAGGGGTGGG + Intergenic
932902488 2:75715462-75715484 CAGAATCTGAGGTGGAGGGTGGG + Intergenic
935808425 2:106771865-106771887 CAGGTTCTGATTTGGTGGGAAGG + Intergenic
937440263 2:121909154-121909176 CTGGACCTGCTGTGATGGGAGGG - Intergenic
946712920 2:222524872-222524894 CATGATTTGATGTCATAGGTGGG - Intronic
947714297 2:232332106-232332128 CAGGGTCGGGTGGGATGGGTGGG - Intronic
947733505 2:232443485-232443507 CAGGGTCGGGTGGGATGGGTGGG - Intergenic
948753309 2:240144718-240144740 GAGGAACTGATGTGATCAGTGGG - Intergenic
949034986 2:241812176-241812198 CAGGATGGGCTGTGAGGGGTTGG + Intronic
1170183320 20:13557916-13557938 CTGCATCGGATGTGATGTGTGGG - Intronic
1171341843 20:24435651-24435673 CAGTATCTAATGGGATGGGCTGG - Intergenic
1172131560 20:32659468-32659490 GATGACCTGAAGTGATGGGTGGG + Intergenic
1172208608 20:33181972-33181994 CAGGCTCTCAGGTGATGGGAGGG - Intergenic
1173835450 20:46122439-46122461 CAGGGTCTGCTCTGATTGGTTGG + Intronic
1174292478 20:49519003-49519025 AAGGATCAGATGTGATGGATGGG + Intronic
1176150489 20:63588360-63588382 CAGGTTCTGAGCTGGTGGGTGGG + Exonic
1178328015 21:31660674-31660696 CAGGTTTTGATGTAATTGGTCGG - Intronic
1178999884 21:37447252-37447274 CAGGATCTTATGTTATAGTTGGG + Intronic
1181976696 22:26735997-26736019 CAGGATATGGTGGGATGGGATGG - Intergenic
1182258166 22:29053023-29053045 CAGGAGCTCATCAGATGGGTTGG - Intronic
949254864 3:2033981-2034003 GAGGATCTGAGCTGATGTGTAGG + Intergenic
951621837 3:24610291-24610313 CAGCATCTGATGAGATGCTTGGG + Intergenic
952860190 3:37806591-37806613 CAGGAGATGCTGTCATGGGTGGG + Intronic
953160397 3:40414400-40414422 CATGAACAGATGAGATGGGTGGG + Intronic
953636575 3:44670011-44670033 CAGGATCAGATGTGGTGGCCTGG + Intergenic
954326776 3:49868346-49868368 CAGGATCTGCTGTTGGGGGTTGG - Intronic
956981055 3:74638133-74638155 CAGGATATGATGTGCTGATTTGG - Intergenic
958021376 3:88001122-88001144 CAGTCGCTGATGTGAAGGGTAGG - Intergenic
960469646 3:118046784-118046806 AAGAATGTGAAGTGATGGGTAGG + Intergenic
965407884 3:168293340-168293362 TAGGATCTGATATGATGTGAAGG + Intergenic
967087978 3:186110962-186110984 CAGGATGTCATGGGATGGGATGG - Intronic
968470974 4:782120-782142 CCGGATCTGCTGTGAGGGGCGGG + Intergenic
969295388 4:6267505-6267527 AAGGATCTGATTTGGTGAGTGGG - Intergenic
970020645 4:11563718-11563740 TAGTATGTGATGTGATGGATAGG + Intergenic
974896352 4:67944346-67944368 CAGAGTATGATGAGATGGGTAGG - Intronic
976217971 4:82732528-82732550 CAGGATCTGATGTGATGGGTAGG - Intronic
979888053 4:126056980-126057002 CATGATCTGAGATCATGGGTTGG - Intergenic
980045038 4:127978433-127978455 CTGGATGTGATGAGATGGATTGG + Intronic
981283847 4:142992241-142992263 CAGGAGCTGATGTGATCAATTGG + Intergenic
986994885 5:13595918-13595940 CAGAAACTGATGTGATTGGTGGG + Intergenic
987158457 5:15115002-15115024 CAGAATCTGTCGAGATGGGTTGG + Intergenic
988125806 5:27034291-27034313 CAAAATCTGATATGAGGGGTTGG + Intronic
989037347 5:37189399-37189421 GAGAATCTGATGTGTGGGGTGGG - Intronic
990173335 5:53079939-53079961 CAGCATCTGTTCTCATGGGTGGG - Intronic
991135589 5:63178183-63178205 GAGGATGTGATTTCATGGGTTGG - Intergenic
993188475 5:84650595-84650617 CAGAATGTTAAGTGATGGGTAGG - Intergenic
995378459 5:111504991-111505013 TAGGACCTGATGTGTTGAGTTGG - Intronic
996591196 5:125149645-125149667 CTGGATTGTATGTGATGGGTTGG - Intergenic
998768053 5:145510548-145510570 CAGCATTTGATGTGAAGGGGAGG + Intronic
1001316062 5:170641994-170642016 CTTGATGTGAGGTGATGGGTGGG - Intronic
1006452180 6:34111669-34111691 CAAGAGCTGATGGGCTGGGTGGG + Intronic
1007625541 6:43244176-43244198 CAGGATCAGAGGAGAGGGGTGGG - Intronic
1009983378 6:70752642-70752664 CAGGAGCTGATGTTTTGGGGAGG - Intronic
1010496509 6:76539093-76539115 CAGGACATGGTCTGATGGGTTGG + Intergenic
1010530326 6:76960200-76960222 CAGGAGCTGATGTGATGAACTGG + Intergenic
1012191673 6:96287486-96287508 CAGTTTCTCAAGTGATGGGTGGG - Intergenic
1019406493 7:886852-886874 CAGGACCTGCTGTGATTCGTAGG + Intronic
1020580505 7:9993179-9993201 CAGGGTCTCATGTGTTGCGTAGG - Intergenic
1023101705 7:36724534-36724556 CCGGAACTGATCTGTTGGGTTGG + Exonic
1023584434 7:41714761-41714783 CAAGAGCTGAGGTCATGGGTCGG + Intergenic
1025717581 7:63976449-63976471 GTGGATCTGATGTGAGGTGTGGG - Intergenic
1026553491 7:71387293-71387315 CAGGAACTGATGTATTAGGTTGG - Intronic
1028167479 7:87554721-87554743 CAGGATCTGACCTGGTGGCTTGG + Intronic
1028377902 7:90166648-90166670 CAGGGTGTAATGTGATGTGTTGG + Intergenic
1030116227 7:106064359-106064381 AAGGATCTGAGGTGCAGGGTGGG + Intergenic
1030872103 7:114768459-114768481 AAGTATCTGATGTGGTGGGTTGG + Intergenic
1032262067 7:130346286-130346308 CAGGAGAGGATGTGCTGGGTTGG + Intronic
1032286046 7:130539193-130539215 CAAGATCAGGTGTGATGGGCAGG + Intronic
1032383888 7:131508277-131508299 GAGGAGCTGATGGGATGGGTGGG - Intronic
1036777137 8:11621182-11621204 CAGGATTTGAGGTGATGGAGTGG - Intergenic
1038379822 8:27082171-27082193 CAAGTTCTGTTGAGATGGGTGGG - Intergenic
1038505918 8:28085011-28085033 CTGTATGTGATGTGATGGTTTGG - Intergenic
1038683904 8:29697670-29697692 AAGGATCTGCTGTAATGTGTTGG - Intergenic
1042286365 8:67116030-67116052 GATGAACTGATGGGATGGGTGGG - Exonic
1048179373 8:132181082-132181104 CAGCATCCCATGTCATGGGTGGG - Intronic
1048870432 8:138792719-138792741 CATTAGCTGATGTGAGGGGTTGG - Intronic
1049447456 8:142637964-142637986 CAGGGAATGATGTGAGGGGTGGG - Intergenic
1049553193 8:143270129-143270151 CAGCAGCTCATGTGCTGGGTTGG - Intronic
1054771745 9:69090033-69090055 CTGGATCTGGTGTGAAGGGATGG - Intronic
1056120810 9:83486441-83486463 CATAAACTGATGTGATGGGCTGG - Intronic
1058862522 9:109129685-109129707 CAGGATCAGATTTGATAGCTGGG + Intergenic
1058977538 9:110138336-110138358 AAGAATCTGACGTGATGGTTGGG + Exonic
1059072147 9:111149136-111149158 CAGGTTCTGCTGTGATGTGTTGG - Intergenic
1060909249 9:127335933-127335955 CAGGAGCAGAGGAGATGGGTTGG + Intronic
1061134557 9:128725880-128725902 CAGGATCTGATGTGCTCAGTGGG + Intergenic
1186388990 X:9139239-9139261 CTGGATCTGATGTGATGGGAAGG + Intronic
1189290291 X:39880263-39880285 CATTATCTGATGGGAAGGGTGGG + Intergenic
1191960093 X:66691760-66691782 CAGGAGCTGATGTGATCAATTGG - Intergenic
1194898175 X:99470786-99470808 CAGGATATGAAGTTCTGGGTTGG - Intergenic
1196745899 X:119071335-119071357 AAAGATCAGATGTCATGGGTGGG + Intergenic
1197556737 X:127964691-127964713 CAGTTTCTCAGGTGATGGGTGGG + Intergenic
1198039716 X:132838148-132838170 CAGGATCTGGTGAAGTGGGTGGG - Intronic
1198042991 X:132872994-132873016 CAGGAAGTGATGGGCTGGGTTGG - Intronic
1199614674 X:149647392-149647414 CAGAATCTGCAGTGATGGTTTGG - Intergenic
1201595321 Y:15661679-15661701 AAGTATTTGAGGTGATGGGTAGG + Intergenic
1201985246 Y:19958294-19958316 CAGGAGCTGAAGTGAAAGGTTGG + Intergenic
1202139855 Y:21710346-21710368 CAGGAGCTGATGTGAAAGCTTGG + Intergenic