ID: 976221584

View in Genome Browser
Species Human (GRCh38)
Location 4:82760656-82760678
Sequence GCTTGACTGAGGGCAGGACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 338
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 316}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976221584_976221594 19 Left 976221584 4:82760656-82760678 CCAAGTCCTGCCCTCAGTCAAGC 0: 1
1: 0
2: 1
3: 20
4: 316
Right 976221594 4:82760698-82760720 ATTAGAACCTCCCCCATCCCTGG 0: 1
1: 0
2: 0
3: 12
4: 157
976221584_976221596 27 Left 976221584 4:82760656-82760678 CCAAGTCCTGCCCTCAGTCAAGC 0: 1
1: 0
2: 1
3: 20
4: 316
Right 976221596 4:82760706-82760728 CTCCCCCATCCCTGGAAACAAGG 0: 1
1: 1
2: 0
3: 33
4: 312

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976221584 Original CRISPR GCTTGACTGAGGGCAGGACT TGG (reversed) Intronic
900595677 1:3479171-3479193 TCTTGACTGAGGACAGCTCTGGG + Intronic
900880912 1:5380735-5380757 TCTTGATTGACAGCAGGACTTGG - Intergenic
902430689 1:16360889-16360911 GATTGCCTGAGGCCAGGAGTTGG - Intronic
905323108 1:37131649-37131671 CCTTCACCTAGGGCAGGACTGGG - Intergenic
905865157 1:41372460-41372482 GCTGGGCTCAGGGCAGGGCTGGG + Intronic
907746277 1:57216844-57216866 ACTTGACGTAAGGCAGGACTGGG + Intronic
910590191 1:88922054-88922076 GCATGACTGAGGGCTGGGCATGG + Intergenic
910963593 1:92785856-92785878 GATTGCCTGAGGTCAGGAGTTGG + Intronic
915916048 1:159941680-159941702 GCCTGACTGAGGGCAAGGCAAGG - Intronic
917478345 1:175387876-175387898 GCTTAAGAGAGGACAGGACTAGG - Intronic
919315950 1:195970466-195970488 ACTTGACTGCTGGCAAGACTAGG - Intergenic
919690864 1:200527298-200527320 GCCTGACTGTGGGCAGAAATGGG + Intergenic
919726865 1:200890450-200890472 GATCGACTGAGGTCAGGAGTTGG - Intergenic
921029150 1:211322095-211322117 TCTTGCCTGAGGCCAGGGCTGGG + Intergenic
922316503 1:224447335-224447357 TGATGACTGAGGGCAGGAGTAGG + Intronic
922354649 1:224764373-224764395 GCCTGACTGGGGGCTTGACTGGG - Intergenic
923559781 1:235030292-235030314 GATTGCCTGAGGACAGGAGTTGG - Intergenic
1063398975 10:5722784-5722806 GATTGCCTGAGGTCAGGAGTTGG + Intronic
1064664641 10:17638342-17638364 GATTGCCTGAGGTCAGGAGTTGG - Intergenic
1065127524 10:22587922-22587944 GGCTCACTGAGGGCAGGTCTGGG - Intronic
1065639227 10:27764852-27764874 GATTGCTTGAGGCCAGGACTTGG - Intergenic
1066371244 10:34819922-34819944 CCTTGACTGGAGGCAGGATTTGG + Intergenic
1066490245 10:35887479-35887501 ACTGGACTCAGGGCAGGGCTGGG + Intergenic
1067817730 10:49495297-49495319 GATTGACTGAGGGCATCACAGGG + Intronic
1068455272 10:57247123-57247145 GATGGCTTGAGGGCAGGACTTGG + Intergenic
1069944370 10:71975786-71975808 GCCTGACTGAGGGCGGCACCGGG - Intronic
1070547153 10:77461589-77461611 CCTTGATTTAGGGCTGGACTAGG + Intronic
1070776321 10:79111954-79111976 GCTTGACCCAGAGTAGGACTTGG + Intronic
1071491840 10:86141442-86141464 GCTCCAGAGAGGGCAGGACTGGG - Intronic
1072277342 10:93836177-93836199 GCTGGAGTGGGGGCAGGAGTGGG - Intergenic
1072761715 10:98062210-98062232 GTTTGGGTGAGGGCAGGACCAGG + Intergenic
1073214969 10:101831075-101831097 CACTGACTGAGGGCAGGGCTTGG + Exonic
1073329923 10:102663494-102663516 GATTGCCTGAGGTCAGGAGTTGG + Intergenic
1073452410 10:103617651-103617673 GCTGGGCCGAGGGCAGGATTAGG + Intronic
1076531675 10:131149212-131149234 GCTCCCCTGAGGGCAGGACCTGG - Intronic
1077340220 11:2023134-2023156 GCCTGCGGGAGGGCAGGACTCGG - Intergenic
1077898575 11:6473057-6473079 GTTCGACTGAGGGCAGGCCCTGG - Intronic
1078110104 11:8385416-8385438 GCTTGATGGAGTCCAGGACTTGG - Intergenic
1078949511 11:16113913-16113935 GGTTAACAGAGGGCAGAACTAGG + Intronic
1079416892 11:20246008-20246030 CCTTGAAGAAGGGCAGGACTTGG - Intergenic
1080086283 11:28286554-28286576 GCTTGACATAGGGGAGTACTAGG + Intronic
1081808052 11:45900681-45900703 GATTGAAGGAGGGAAGGACTGGG + Intronic
1083603048 11:63960890-63960912 GTTTGACTCAGAGCAGGGCTTGG + Intergenic
1083948948 11:65943262-65943284 CCTTGGCAGAGGGCAGGTCTGGG - Intergenic
1083949196 11:65944758-65944780 GATTGCCTGAGGTCAGGAGTTGG - Intergenic
1084411631 11:69009332-69009354 GGTTGGCTGAGGGCAGGAGGAGG + Intronic
1084869150 11:72084309-72084331 GCCTGAGAGAGGGCAGGAATAGG + Intronic
1084992141 11:72936551-72936573 GCTTGCTTGAGGCCAGGAGTTGG + Intronic
1085346844 11:75773653-75773675 GCTTCACTGAGGAAGGGACTTGG + Intronic
1085637086 11:78167295-78167317 GCTTGGCTTAGGTCAGGACATGG + Intergenic
1088030556 11:105243466-105243488 GTTTGCTTGAGGCCAGGACTTGG - Intergenic
1088417028 11:109600514-109600536 GATTGCCTGAGGTCAGGAGTTGG + Intergenic
1089211920 11:116810107-116810129 GATTGCCTGAGGTCAGGAGTTGG - Intergenic
1089982163 11:122781213-122781235 GCTTCACTGAAGTCAGGACCCGG - Intronic
1090463723 11:126914128-126914150 TCATGACAGAGGGCAGGAATTGG - Intronic
1091303085 11:134520092-134520114 GCTCGACTAAGAGCAGGACGAGG + Intergenic
1091344137 11:134841532-134841554 GCATGTCTGAGGGCAGGATGTGG + Intergenic
1202823205 11_KI270721v1_random:78323-78345 GCCTGCGGGAGGGCAGGACTCGG - Intergenic
1093484854 12:19641634-19641656 GCTTGAGTGCTGGGAGGACTTGG - Intronic
1095401515 12:41819605-41819627 GCTTCTCTGGGGGCAGAACTTGG - Intergenic
1096747888 12:53740090-53740112 GCTTCAGTGACGGCAGGACAGGG + Intergenic
1096979527 12:55720279-55720301 GCCTGGCTGAAGCCAGGACTTGG - Intronic
1096984119 12:55745127-55745149 GATCGACTGAGGGCAGGGGTAGG + Intronic
1097014329 12:55974406-55974428 GCTTGAGTGAGGGCAGGGGCAGG + Intronic
1097287733 12:57890433-57890455 GCTTCACTGAGGTGAGGAGTGGG - Intergenic
1100601451 12:96114807-96114829 GATTGCCTGAGGCCAGGAGTTGG + Intergenic
1101247232 12:102895623-102895645 GATTGCCTGAGGTCAGGAGTTGG + Intronic
1102400872 12:112628506-112628528 GCTTGCTTGAGGCCAGGAGTTGG + Intronic
1102712673 12:114941834-114941856 GGTTGACTGAGGGCATCCCTGGG - Intergenic
1104161252 12:126182814-126182836 GCTTGGCTGATGGCAGCTCTGGG + Intergenic
1105213581 13:18271967-18271989 GTTAGACTGTGGGCAGGACTTGG + Intergenic
1105420956 13:20251891-20251913 GCTCACCTGAGGCCAGGACTTGG - Intergenic
1106809130 13:33342292-33342314 GCTTTACTTTTGGCAGGACTTGG - Intronic
1106850026 13:33780407-33780429 GCTTGATTGAGAGCAGGCCAAGG - Intergenic
1107891985 13:44921899-44921921 GAATGATTGAGTGCAGGACTGGG - Intergenic
1108314748 13:49226209-49226231 GATCGATTGAGGCCAGGACTTGG - Intergenic
1109263500 13:60170310-60170332 GATTGCCTGAGGTCAGGAGTTGG + Intergenic
1111970414 13:94908568-94908590 GATTGCCTGAGGCCAGGAGTTGG + Intergenic
1113549630 13:111182495-111182517 GCTTGGCTGTGGGCATGGCTGGG + Intronic
1113773894 13:112931256-112931278 GCGTGACTCTGGGCAGGAGTGGG + Intronic
1114207996 14:20591207-20591229 GATTGACAGAGGGAGGGACTTGG - Intronic
1114693380 14:24605939-24605961 GGTTGACTGAGCTCAGGGCTGGG + Intergenic
1115479294 14:33845732-33845754 CCATCACTGAGGACAGGACTAGG + Intergenic
1118797927 14:69160977-69160999 GATTGCCTGAGGTCAGGAGTTGG + Intergenic
1119505102 14:75165968-75165990 GCTTGACTTGGGGGAGGAGTGGG + Intronic
1119788447 14:77329316-77329338 GCATGGATGAGGGCAGGACTGGG + Intronic
1119866035 14:77975381-77975403 GAATGGCTGAGGACAGGACTGGG + Intergenic
1122625814 14:103084894-103084916 GCTTGATGGAGGGCCGGACCTGG + Intergenic
1122745026 14:103892408-103892430 GCTGCAGTGAGGGCTGGACTAGG - Intergenic
1122892118 14:104736966-104736988 GATTGCCTGAGGCCAGGAGTTGG - Intronic
1123756422 15:23400777-23400799 GATTGCTTGAGGGCAGGAGTTGG + Intergenic
1124223608 15:27870421-27870443 GCTTGGCTCAGGGCAGGAACTGG - Intronic
1125879739 15:43183903-43183925 GGTGGAGTGAGGGGAGGACTTGG - Intronic
1126038592 15:44569927-44569949 GATTGCCTGAGGTCAGGAGTTGG - Intronic
1129232912 15:74206577-74206599 GCTCTCCTGAGGGCAGGGCTGGG - Intronic
1129459578 15:75693775-75693797 GGTTGGCTGAGGCCACGACTGGG + Intronic
1129564799 15:76610002-76610024 TCTTTCCTGAGGGCAGGGCTTGG + Intronic
1131468248 15:92673005-92673027 GCTTGTCTCAGGGCAGTCCTTGG - Intronic
1132132790 15:99298928-99298950 GATTGCCTGAGGTCAGGAGTTGG - Intronic
1132436790 15:101812470-101812492 GCTTGGTTCAGGGCAGGACTAGG + Intronic
1132531409 16:451925-451947 GATTGCCTGAGGTCAGGAGTTGG + Intronic
1133815487 16:9194338-9194360 GCTTAACAGAAGGCATGACTGGG - Intergenic
1134168429 16:11948914-11948936 GATTGCTTGAGGCCAGGACTTGG + Intronic
1135282390 16:21163921-21163943 GATTGCCTGAGGTCAGGAGTTGG - Intronic
1135556010 16:23437140-23437162 GCTTGACTCTAGGCAGGACATGG - Intronic
1135647605 16:24176669-24176691 GATTGCCTGAGGTCAGGAGTTGG + Intronic
1136064089 16:27747139-27747161 CCCAGACTGAGGGTAGGACTGGG + Intronic
1136590232 16:31214212-31214234 GCTGGACTGGGGTCAGGGCTGGG - Exonic
1136910868 16:34142940-34142962 GATTGCCTGAGGTCAGGAGTTGG + Intergenic
1137845808 16:51686959-51686981 TCTTGACTCAAGGCTGGACTGGG + Intergenic
1140500557 16:75430390-75430412 GATTGCCTGAGGTCAGGAGTTGG - Intronic
1142368173 16:89661756-89661778 GCGTGACTGAGCCCAGGTCTAGG - Intronic
1142546634 17:708547-708569 GGATGACTGTGGGCAGGCCTGGG + Intronic
1143649322 17:8253758-8253780 GATTGCCTGAGGTCAGGAGTTGG - Intronic
1144798028 17:17905726-17905748 GCCTGACTGGGGGCAGGCCAAGG - Intronic
1146246308 17:31286314-31286336 GATTACCTGAGGTCAGGACTTGG - Intronic
1146835414 17:36106807-36106829 GGGTGACTAAGGGCAGGACAAGG - Intergenic
1147119197 17:38325693-38325715 CCTTGACTGTGGGGAGGACCTGG + Exonic
1148243661 17:46016168-46016190 GATTGCCTGAGGTCAGGAGTTGG + Intronic
1148331431 17:46816168-46816190 GCTTGACTGTGTTCATGACTGGG - Intronic
1148911003 17:50942729-50942751 GCGTCACTGAGGGAAGGACCAGG - Intergenic
1148931654 17:51131956-51131978 GATTGCCTGAGGTCAGGAGTTGG + Intergenic
1149508557 17:57216954-57216976 GATTGCCTGAGGCCAGGAGTTGG - Intergenic
1149637146 17:58180110-58180132 ACTTGACTGAGAGCAGGTGTGGG - Intergenic
1151393386 17:73802939-73802961 GCTTGACTGGGCTCAGAACTGGG + Intergenic
1151648210 17:75448352-75448374 GCTTGCGTGAGGCCAGGAGTTGG - Intronic
1152314287 17:79571338-79571360 GCTTGACAGAGGCCAGGTCAGGG - Intergenic
1152366345 17:79858881-79858903 GCTGGACCCAGGGCAGGACTAGG - Intergenic
1152370088 17:79881577-79881599 GGTTGCCAGAGGTCAGGACTGGG - Intergenic
1152409571 17:80116726-80116748 GCTGGGCTCAGGGCAGGAATAGG - Intergenic
1153849341 18:9078575-9078597 GATTGCCTGAGGTCAGGAGTTGG - Intergenic
1153955020 18:10088722-10088744 GCTTCTCTGAGGACAGGTCTTGG + Intergenic
1154414930 18:14171499-14171521 GCCTGCATGAGGGCAGGACCAGG + Intergenic
1157762125 18:50272925-50272947 GCTTCACAGAAGGCAGGCCTGGG + Exonic
1158867046 18:61648275-61648297 CCTTGACTGAGGGCGGGGCTGGG - Intergenic
1159331234 18:66996422-66996444 GATTGTCTGAGGTCAGGAGTTGG + Intergenic
1160168995 18:76537546-76537568 GATTGCCTGAGGTCAGGAGTTGG - Intergenic
1161779502 19:6281694-6281716 GATTGCCTGAGGCCAGGAGTTGG - Intergenic
1162332941 19:10041499-10041521 CCCTGACTGAGGTCAGGACATGG + Intergenic
1162475399 19:10896533-10896555 GCTTGGCTCTGGGCAGCACTGGG - Intronic
1162687231 19:12398027-12398049 GATTGCCTGAGGTCAGGAGTTGG + Intronic
1162803111 19:13121901-13121923 GCTTGTGTGAAGGAAGGACTAGG - Intronic
1163244073 19:16081826-16081848 GGTTAACAGAGGGCAGGACATGG + Intronic
1163362421 19:16855497-16855519 GATTGCCTGAGGTCAGGAGTTGG + Intronic
1163655511 19:18543130-18543152 GCTTGACTGAGGGCCCGGCCGGG - Intronic
1164322295 19:24160274-24160296 GCTTTCCTGAGGTCAGGAGTTGG + Intergenic
1164982176 19:32622308-32622330 TATTGCCTGAGGGCAGAACTTGG - Intronic
1165083797 19:33328666-33328688 GCTTGACTGGGGGCAGAAGGAGG - Intergenic
1165873490 19:38989562-38989584 GATTGACTGGTGGCAGGGCTGGG - Intergenic
1165898369 19:39156539-39156561 CCTGGACAGAGGGCAGGGCTGGG - Intronic
1166928335 19:46285111-46285133 GCTTGAATGAGGGCCAGGCTTGG + Intergenic
1167381896 19:49143049-49143071 GCTAGACTGAGGGCAAGAGGCGG - Intronic
1168274003 19:55266098-55266120 CCTTGAGTGAGGGCAGGAGTGGG - Intronic
1168359092 19:55723387-55723409 GGTTGCCTGAGGGCAGAACCAGG + Intronic
926814555 2:16787325-16787347 GCTCAAGTGAGGGAAGGACTGGG + Intergenic
927104089 2:19809332-19809354 GCTTGACTGAGAGCTGGTTTTGG - Intergenic
927434170 2:23052968-23052990 GCTTGACTGGAAGCATGACTGGG - Intergenic
928363979 2:30687678-30687700 GCTTGACTGTAGGCAGATCTGGG - Intergenic
928743050 2:34378179-34378201 GATTGCCTGAGGTCAGGAGTTGG + Intergenic
929685386 2:44029554-44029576 GCCTGGGTGAGGGCAGGAATGGG - Intergenic
929801634 2:45109464-45109486 GCTTGACAGTGGGGAGGTCTGGG + Intergenic
930072119 2:47374857-47374879 GATTGCCTGAGGTCAGGAGTTGG - Intronic
930730522 2:54723981-54724003 GCTGGGCTCAGGGCAGGACCCGG + Intronic
931353014 2:61509224-61509246 GGTTGCCTGAGGTCAGGAGTTGG - Intronic
931512892 2:63019965-63019987 GATTGCCTGAGGTCAGGAATTGG + Intronic
931723124 2:65081916-65081938 GATTGCCTGAGGTCAGGAGTTGG - Intronic
932668377 2:73716368-73716390 GGGTGACTGCCGGCAGGACTTGG + Intergenic
932810289 2:74819894-74819916 GCTTAACTGAGAGCAGGATGTGG - Intergenic
933911409 2:86943787-86943809 GATTGCCTGAGGTCAGGAGTTGG + Intronic
934300748 2:91774779-91774801 GTTAGACTGTGGGCAGGACTTGG - Intergenic
934692808 2:96374839-96374861 GGCTGACTGAGGGAAGGAATGGG - Intergenic
935166481 2:100573450-100573472 GATTGCCTGAGGTCAGGAGTTGG + Intronic
936416494 2:112319276-112319298 GATTGATTGAGGCCAGGAGTTGG + Intronic
938157285 2:128952272-128952294 GCTTGAAGGAGGGGAGGAATGGG - Intergenic
939593807 2:144100206-144100228 GTTTCACTGAGAGCAGAACTTGG - Intronic
939626711 2:144485838-144485860 GATTGCCTGAGGTCAGGAGTTGG - Intronic
941759929 2:169231070-169231092 GATGGCCTGAGGGCAGAACTTGG + Intronic
942316116 2:174697774-174697796 GCTTGACTGTGGGCAGTGGTAGG + Intergenic
943459716 2:188156506-188156528 GCTTGACAGAGGTCAGGATCAGG - Intergenic
947086645 2:226460278-226460300 GATTGCCTGAGCCCAGGACTTGG + Intergenic
947417599 2:229914044-229914066 GATTGCCTGAGGTCAGGAGTTGG + Intronic
947825835 2:233105548-233105570 GCTGGACTGTGGGCAGGGCCTGG + Intronic
948769109 2:240238974-240238996 GCTTGCCTGAGGCCAGGGGTTGG - Intergenic
948904964 2:240975388-240975410 ACTGGCCTGAGGGCAGGACGGGG + Intronic
948915765 2:241034438-241034460 GGTTGGCTGAGGTCAGGACCTGG + Intronic
1169462412 20:5807109-5807131 GCTGGGCTGAGGGCAGCTCTTGG + Intronic
1170570706 20:17630777-17630799 GCTTGTCTGGGGGCAGAACCAGG + Intronic
1170778876 20:19405262-19405284 GCGTGACTGAAACCAGGACTTGG + Intronic
1170847166 20:19972089-19972111 GCCTGTCTGATGGCAAGACTGGG + Intronic
1170946103 20:20892230-20892252 TCTTGAGTGTGGGCAGGACCAGG + Intergenic
1170976047 20:21165656-21165678 CCTTGAGAGTGGGCAGGACTGGG + Intronic
1172656907 20:36543069-36543091 ACTGGACTCAGGGAAGGACTAGG + Intronic
1173147155 20:40534747-40534769 GCTTGGCTGAGGACAGGACTGGG - Intergenic
1174074333 20:47921941-47921963 GCTTGCAAGTGGGCAGGACTTGG - Intergenic
1174143883 20:48436861-48436883 GCTTGCAAGTGGGCAGGACTTGG + Intergenic
1174611289 20:51800826-51800848 GCTTGACGGAGGGGATGGCTGGG - Intronic
1174802173 20:53573678-53573700 GCTCGATTGAGGCCAGGAGTTGG - Intronic
1175203089 20:57291272-57291294 GCCTGCCTGAAGGCAGGGCTAGG - Intergenic
1175518823 20:59586745-59586767 GCAGGACTGAGGACAGGACCTGG - Intronic
1175817655 20:61891792-61891814 GGTGAACTGAGGGCAGGGCTGGG - Intronic
1175942804 20:62545744-62545766 GCTGGGCTGTGGGCAGGACAGGG - Intergenic
1176866063 21:14055897-14055919 GCCTGCATGAGGGCAGGACCAGG + Intergenic
1177818140 21:26000385-26000407 GGTTTAATGAGTGCAGGACTCGG + Intronic
1179255350 21:39711058-39711080 CCTGAACTGAGGGCAGGAGTTGG + Intergenic
1180733241 22:17997671-17997693 CCTTGACTGAAAGCAGGGCTGGG - Intronic
1180816414 22:18792358-18792380 GTTAGACTGTGGGCAGGGCTTGG + Intergenic
1180873781 22:19164309-19164331 GATTGCCTGAGGTCAGGAGTTGG + Intergenic
1180921329 22:19523065-19523087 GCTTGAGAGAGGGCGGGAGTGGG - Exonic
1181202601 22:21226690-21226712 GTTAGACTGTGGGCAGGGCTTGG + Intronic
1181595335 22:23910904-23910926 GCTGGACTCAGGGCAGGGCCAGG + Intergenic
1181699102 22:24609915-24609937 GTTAGACTGTGGGCAGGGCTTGG - Intronic
1182087966 22:27574485-27574507 GATGGACTGGGTGCAGGACTTGG + Intergenic
1183239564 22:36647232-36647254 GAGTGACTGAGGGCAGACCTGGG - Intronic
1183963903 22:41429701-41429723 CCTTGGCAGAGGGCAGGGCTGGG + Intergenic
1184342998 22:43896305-43896327 GGTTTTCTGAGGGCAGGTCTGGG + Intergenic
1184749187 22:46474415-46474437 GCTTGTCTGAGGCTAAGACTAGG - Intronic
1184989343 22:48156502-48156524 GCCTGACTGGGGACAGGAATGGG + Intergenic
1203224312 22_KI270731v1_random:68723-68745 GTTAGACTGTGGGCAGGGCTTGG - Intergenic
1203266514 22_KI270734v1_random:18069-18091 GTTAGACTGTGGGCAGGGCTTGG + Intergenic
950035949 3:9885754-9885776 GATTGCCTGAGGTCAGGAGTTGG + Intergenic
953176737 3:40560354-40560376 GATTGCCTGAGGTCAGGAATTGG - Intronic
953237282 3:41117793-41117815 GCCTGACTGAGGCCAGGTTTAGG - Intergenic
954807093 3:53226898-53226920 GCGTGGCTGAGGGGAGGGCTGGG + Intronic
954957915 3:54538218-54538240 GCTTGACTGAGAGCAATATTTGG + Intronic
956772457 3:72537985-72538007 CCATGACAGATGGCAGGACTGGG + Intergenic
957878418 3:86179103-86179125 TCTTGACTGAGGGCATGCCCAGG - Intergenic
960631650 3:119738164-119738186 TCTTGGCTGAGGGCAGGTGTTGG + Intronic
960923370 3:122771427-122771449 GCTCAACTGAGGTCAGGATTTGG + Intronic
961005894 3:123405193-123405215 GCATGAGAGAGGACAGGACTGGG - Intronic
961577231 3:127847438-127847460 GCTTGACAGAGGGAAGGAGGAGG + Intergenic
961756119 3:129128301-129128323 GCTTGACTGAGGGCTGGGATTGG + Intronic
961861216 3:129918060-129918082 GCTAGTCTGAAGGTAGGACTGGG - Intergenic
964043719 3:152296365-152296387 GCTTAACTGTGGGCAGGAGGAGG + Intronic
964399664 3:156285722-156285744 GATTGACTGAGCTCAGGAGTTGG - Intronic
966246813 3:177817884-177817906 GCTTGAATGTGGGCAGCACAGGG + Intergenic
966802578 3:183777879-183777901 GATTGCCTGAGGTCAGGAGTTGG + Intronic
967472976 3:189884422-189884444 GATGCACTGAGGGCAGAACTAGG - Intronic
968173233 3:196527275-196527297 GTTTGACTGAAGGCAGGAGAAGG - Intergenic
969354756 4:6618902-6618924 GCCTGCCTGAGAGCAGGTCTAGG + Intronic
969396758 4:6926830-6926852 TCTTTGCTGAGGGCAGGGCTGGG + Intronic
970108006 4:12606770-12606792 GCTTGAATGCGGGCTAGACTAGG - Intergenic
973843060 4:54882088-54882110 GCTTGAGGGAGGACAGCACTGGG - Intergenic
975620812 4:76294741-76294763 GCTTTACTGAAGGAAGGAATGGG + Intronic
976221584 4:82760656-82760678 GCTTGACTGAGGGCAGGACTTGG - Intronic
976500635 4:85784665-85784687 GTTTGACTGAGGGAAAGACATGG - Intronic
976798073 4:88957102-88957124 GATTGCCTGAGGTCAGGAGTTGG + Intronic
980698105 4:136386189-136386211 GATCGACTGAGGTCAGGAGTTGG + Intergenic
980874223 4:138644795-138644817 GCTTGACTAAGGGCATGAGTTGG + Intergenic
981095054 4:140770408-140770430 GCTTGCTTGAGGCCAGGAGTTGG + Intergenic
983187540 4:164717526-164717548 GATTGCCTGAGGCCAGGAGTTGG - Intergenic
985676602 5:1234694-1234716 GCTTGGCTGAGGGAAGGGCATGG - Intronic
986758974 5:10862747-10862769 GTTTGAATGAAGGCAGGAGTTGG + Intergenic
991215295 5:64152833-64152855 GCTTGAATGATGGCAGAAATGGG - Intergenic
992838819 5:80667674-80667696 GCGTGAGTGAGGGCTGGACCAGG + Intronic
993823617 5:92652877-92652899 GCTTGTCTAAGGGCAGGATTTGG + Intergenic
997519263 5:134512210-134512232 GATTGCCTGAGGCCAGGGCTTGG - Intergenic
997628933 5:135351782-135351804 GATTGAGTGAGGCCAGGAGTTGG - Intronic
997878869 5:137572291-137572313 GCTGGACTGAGTGCAGGAGTTGG - Intronic
999266086 5:150267849-150267871 CCTTGGCTGAGGGGAGGAGTGGG - Intronic
999773466 5:154792799-154792821 GAGTGACTGGGAGCAGGACTTGG + Intronic
1000435015 5:161197392-161197414 GATGGGCTGATGGCAGGACTGGG - Intergenic
1001523716 5:172414018-172414040 GCTTTTCTGAGGACAGGTCTAGG - Intronic
1002159992 5:177309399-177309421 GCTGGCCTGTGGGCAGGACCTGG - Intronic
1002200220 5:177523895-177523917 GCTTGAGTGTGGGCAGGACCTGG + Intronic
1002447848 5:179301022-179301044 GCTTCACTGAGGCCAGGAGGGGG - Intronic
1003132692 6:3408917-3408939 GATTGCCTGAGGGCAGGACCAGG + Intronic
1003749377 6:9039613-9039635 GCTTACCTGAGGTCAGGAGTTGG + Intergenic
1007739760 6:44003258-44003280 GCCTCACTGGGGGCAGAACTTGG + Exonic
1007935257 6:45727030-45727052 GATTGCCTGAGGTCAGGAGTTGG + Intergenic
1008365847 6:50678841-50678863 GATTGCCTGAGGCCAGGAGTTGG + Intergenic
1011417654 6:87139377-87139399 GCTTGAGTGAGGGCAAGGGTGGG + Intergenic
1017729886 6:157305875-157305897 GCTGGACTGAGAGCAGGAAGGGG + Intronic
1018031427 6:159844923-159844945 GATTGACTGCGGGCTGAACTGGG - Intergenic
1018042361 6:159936192-159936214 CCTTGAGTGTGGGCAGGACCTGG - Intergenic
1018995788 6:168709599-168709621 GGTGGACAGAGGGCAGGATTGGG + Intergenic
1019409208 7:899311-899333 GCTTCACTCAGGCCAGGACTCGG + Intronic
1019920211 7:4158385-4158407 GAATGCCTGAGGGCAGGACAGGG + Intronic
1020063032 7:5166918-5166940 GATTGATTGAGGCCAGGAGTTGG - Intergenic
1020165216 7:5802251-5802273 GATTGATTGAGGTCAGGAGTTGG + Intergenic
1021869818 7:24993518-24993540 GATTGCCTGAGGTCAGGAGTTGG - Intergenic
1022506891 7:30913132-30913154 GCTTGAATGGGGTCTGGACTGGG + Intronic
1022627969 7:32057619-32057641 CCCTGACTGAGGGCAGGAGAAGG - Intronic
1025894226 7:65684517-65684539 AAGTGAATGAGGGCAGGACTAGG - Intergenic
1026870113 7:73845839-73845861 GGATGACTGCGGGCAGGCCTGGG - Intergenic
1027642465 7:80754156-80754178 GATTGCCTGAGGTCAGGAGTTGG - Intronic
1027910055 7:84238936-84238958 GATTGCCTGAGGTCAGGAGTTGG - Intronic
1029304040 7:99605807-99605829 GATTGCCTGAGGCCAGGAGTTGG - Intronic
1030053864 7:105564306-105564328 GCTTGCCTGAGGTCAGGAGTTGG - Intronic
1030077191 7:105746897-105746919 GGGTGACTGCGGGCAGGAGTAGG + Intronic
1031593763 7:123624624-123624646 GCTTGACACAGGGCTGGTCTAGG - Exonic
1032428882 7:131844421-131844443 GCTTGACAGAGGACAGTGCTGGG + Intergenic
1033276950 7:139978866-139978888 GATTGCCTGAGGCCAGGAGTTGG + Intronic
1033596954 7:142865525-142865547 GCGTGACTGCGGGCAGGGCATGG - Exonic
1034481453 7:151322934-151322956 GCTTTACTGAGGGAATGACAAGG + Intergenic
1035061022 7:156069715-156069737 GATTGCCTGAGGTCAGGAGTTGG - Intergenic
1035187790 7:157139410-157139432 GCTGGACTCGGGGCTGGACTCGG + Intronic
1036712179 8:11087073-11087095 AGTAGAGTGAGGGCAGGACTGGG - Intronic
1037443980 8:18946352-18946374 GATTGCCTGAGGCCAGGAGTTGG + Intronic
1038359671 8:26864786-26864808 GCGTGACTGAGTGCAGGTGTCGG + Exonic
1038426121 8:27465030-27465052 CCTTGACTGATGGTAGGATTTGG + Intronic
1039507360 8:38061580-38061602 GATTGATTGAGGCCAGGAGTGGG + Intergenic
1039540251 8:38361349-38361371 GCTTGCTTGAGGCCAGGAGTTGG - Intronic
1040559345 8:48510420-48510442 GCTTCATTGAGGACAGGCCTGGG + Intergenic
1042285520 8:67105603-67105625 GATTGCCTGAGGTCAGGAGTTGG - Intronic
1042430576 8:68701810-68701832 GCTTGAATGAGGGGAGGAATGGG - Intronic
1042744678 8:72095139-72095161 GCCTGACTGAGGGCAGTAAATGG + Intronic
1044382021 8:91545143-91545165 CCTTGAGTGAGGGCTGGACATGG + Intergenic
1044547073 8:93471929-93471951 ACTTGATGGTGGGCAGGACTGGG - Intergenic
1045062303 8:98420974-98420996 TCATGGCTAAGGGCAGGACTGGG + Intronic
1047250753 8:123180599-123180621 GCTAGACTAGGGACAGGACTTGG + Intronic
1047454176 8:124994033-124994055 GATTGATTGAGGCCAGGAGTTGG + Intergenic
1048426935 8:134331660-134331682 GCTTGCCTGAAGGCTGGATTTGG - Intergenic
1048510221 8:135055170-135055192 GCTTCACTGAGGGCTGGAAGGGG + Intergenic
1048853341 8:138664927-138664949 ACTGGACTGAGGGCAGGATGTGG - Intronic
1049211437 8:141388253-141388275 GCTTGAGGGAGGCCAGGACTCGG - Intergenic
1049222602 8:141434772-141434794 GCTTGGGTGGGGGCAGGCCTGGG + Intergenic
1049339522 8:142104623-142104645 GCTTTACTGAGGCCAGGACGTGG - Intergenic
1050703329 9:8365903-8365925 GGTTGACTTGGGGCAGGACATGG - Intronic
1052851438 9:33380773-33380795 GGTGGACTGAGGCCAGGCCTTGG - Intergenic
1052857438 9:33415994-33416016 GCCTCACTGAGAGCAGGTCTTGG + Intergenic
1058867520 9:109175205-109175227 TCTTTACTGAGGGCCGGGCTTGG - Intronic
1059046808 9:110878011-110878033 GCTAGACTGAAGGCAGGAAGTGG + Intronic
1059284666 9:113162147-113162169 GCTGGACAGAGGGCAGAACAGGG - Intronic
1060222824 9:121773505-121773527 GCTAGTCAGAGGGCAGGGCTGGG + Intronic
1060747201 9:126145533-126145555 GCCTGACTGGGGGCTGGCCTGGG + Intergenic
1061326442 9:129867532-129867554 GCGTGGCTTGGGGCAGGACTCGG + Intronic
1061487776 9:130928998-130929020 GCTTGGCTGGGGGCAGGGGTGGG + Intronic
1062090067 9:134671300-134671322 GGTGCACTGGGGGCAGGACTTGG - Intronic
1062399492 9:136366215-136366237 GCCTGTCTGGGGGAAGGACTGGG - Intronic
1187195847 X:17082801-17082823 GTATGACTGAGGACAGGACTGGG + Intronic
1189151539 X:38713649-38713671 GGTTGCCTGGGGGCAGGTCTAGG + Intergenic
1189345679 X:40239610-40239632 GTTTGCCTGAGGTCAGGATTTGG - Intergenic
1189389662 X:40565104-40565126 GGGTGGCTGAGGGCAGGAGTGGG - Intergenic
1189846784 X:45145812-45145834 GCCTGGCTGAGGGCTGGGCTGGG + Intergenic
1194983043 X:100460113-100460135 GATTGCCTGAGGTCAGGAGTTGG + Intergenic
1195504530 X:105642150-105642172 GCAGGAGTGAGGGCAGGAGTGGG - Intronic
1196800975 X:119543081-119543103 GATTGCCTGAGGCCAGGAGTTGG - Intronic
1197936797 X:131747786-131747808 GATTGACTGAGGTCAGGAGTTGG + Intergenic