ID: 976222845

View in Genome Browser
Species Human (GRCh38)
Location 4:82771918-82771940
Sequence GCTGCTTTTGATCATGAGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 142}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976222845_976222846 -2 Left 976222845 4:82771918-82771940 CCACACTCATGATCAAAAGCAGC 0: 1
1: 0
2: 1
3: 9
4: 142
Right 976222846 4:82771939-82771961 GCCATAGAATGTGTTAAGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976222845 Original CRISPR GCTGCTTTTGATCATGAGTG TGG (reversed) Intronic
900275196 1:1821373-1821395 GCTCCTTTTGATTATTATTGAGG - Intronic
903084935 1:20847811-20847833 GAAGTTTTTGATGATGAGTGAGG - Intronic
905031192 1:34885544-34885566 GATGGTCTTGATGATGAGTGTGG + Exonic
908171664 1:61511249-61511271 GCTGCCTTTGCTCCTCAGTGCGG + Intergenic
909058613 1:70852393-70852415 GCTCCTTGTCATGATGAGTGTGG + Intronic
910255157 1:85240468-85240490 GCTGCTTTTGGGCATCAGAGAGG + Intergenic
910257228 1:85259845-85259867 GCTGCTTTTGCTCATTTCTGAGG + Intergenic
913474250 1:119221538-119221560 GCTGCTTTGGAGTATGAGTTGGG + Intergenic
917155578 1:171994978-171995000 TCTGATTTTCATCATGACTGTGG + Intronic
917847001 1:179027642-179027664 ACTGCACTTTATCATGAGTGAGG - Intronic
921065160 1:211617295-211617317 GATGCTTTTGATCATTAGCCAGG - Intergenic
921246015 1:213241502-213241524 GCTGCTTTTGATGATGTCAGTGG + Exonic
922390201 1:225133497-225133519 GCTTGTTTTGATCATGTTTGTGG + Intronic
924149258 1:241111271-241111293 GCTTCTTTTGAGCTTGAATGAGG - Intronic
1063040035 10:2328826-2328848 GCTGCTTTTGAGCGAGAGTTTGG + Intergenic
1064569038 10:16673297-16673319 CCTGCTTTTGAGAATAAGTGTGG - Intronic
1065945114 10:30599174-30599196 GCTGCTTTTTATAAATAGTGTGG - Intergenic
1066978650 10:42391569-42391591 GCTCTTTTTCATCAGGAGTGAGG + Intergenic
1070585740 10:77764622-77764644 GCTGCCTTTGCTCAGGAGTCAGG - Intergenic
1076479692 10:130777014-130777036 GCTACATTTCAGCATGAGTGGGG + Intergenic
1079537182 11:21528298-21528320 GCTGATTTTGATCTCCAGTGTGG + Intronic
1080926628 11:36764024-36764046 CTTGCTTTTGCTCATGAGTGTGG + Intergenic
1081346165 11:41989070-41989092 GTTGCTTTCAATCATGGGTGTGG + Intergenic
1084551452 11:69845540-69845562 TCTGCTTTTGATGGGGAGTGGGG + Intergenic
1085631480 11:78120949-78120971 GCTCCTTCTGAAAATGAGTGTGG - Intronic
1086557009 11:88122427-88122449 GCTGCTGTTTTTCATGAATGGGG - Intronic
1086853047 11:91833791-91833813 TCTGTTTTTTATTATGAGTGAGG - Intergenic
1089017881 11:115181848-115181870 GCTGCTTCATGTCATGAGTGAGG - Intronic
1090967462 11:131611417-131611439 GCTGCATATGAACATGAATGTGG + Intronic
1091424994 12:380154-380176 GCTGCTTCTGAGGCTGAGTGAGG + Intronic
1093199101 12:16165623-16165645 GCTGCATTTGAGGAAGAGTGGGG - Intergenic
1095762244 12:45852582-45852604 GATACTTTTGATCCTGAGTCGGG - Exonic
1096420228 12:51450937-51450959 GGTGCTTCTGGCCATGAGTGCGG - Exonic
1098636411 12:72789664-72789686 GCCACTATTGATCATGGGTGAGG - Intergenic
1099514078 12:83574709-83574731 GCTGCTATTTTTCATGACTGTGG + Intergenic
1100144874 12:91665453-91665475 GCTACTTGTGAAAATGAGTGTGG + Intergenic
1101522563 12:105497290-105497312 GGTGATTTTCATAATGAGTGAGG + Intergenic
1102316560 12:111892821-111892843 ACTGCTTTTGATCAGTGGTGGGG + Intronic
1105780827 13:23704070-23704092 GCTGCTTGGCATCATGAGAGTGG - Intergenic
1106257959 13:28038822-28038844 GCAGCTTTAGATGAGGAGTGTGG + Intronic
1107416664 13:40207445-40207467 GCCACTTTTGAATATGAGTGAGG - Intergenic
1107960701 13:45555483-45555505 ACAGCTTTACATCATGAGTGTGG - Intronic
1108749618 13:53434832-53434854 GTTGCATTTCATCATGAGTGAGG - Intergenic
1112492147 13:99876814-99876836 TCTCGTTTTGGTCATGAGTGTGG - Intronic
1112751054 13:102583604-102583626 GCAGGTTTTGAACATCAGTGAGG + Intergenic
1113898641 13:113783421-113783443 GCTCCTTTTCATCAGGAGTGAGG + Intronic
1114979553 14:28145656-28145678 CCTGCTTTTGATCAGAAGTGAGG - Intergenic
1118639118 14:67776007-67776029 GCTGCTTATGAACATGAAGGTGG - Exonic
1120701514 14:87704082-87704104 GCTGATGTTGATGAGGAGTGTGG - Intergenic
1121782342 14:96629995-96630017 GCTGCTCTTGAACAGGAGTGAGG + Intergenic
1122109441 14:99486605-99486627 GCTGGTTTTGATAAGGAGGGAGG - Intronic
1122667509 14:103342697-103342719 GCTGCCTTTGATCAAGATTCGGG + Exonic
1123172757 14:106389934-106389956 GCTGCTTTTTATCAGGAAAGGGG + Intergenic
1127221140 15:56882684-56882706 GATGCACTTGCTCATGAGTGGGG + Intronic
1127346376 15:58104780-58104802 GCTGCTTTTTACCATCATTGTGG + Intronic
1128874774 15:71193119-71193141 CCTGCTTTTGATCAGGAGCTGGG + Intronic
1131733056 15:95302250-95302272 GCTGGTTTCAAGCATGAGTGTGG + Intergenic
1138950332 16:61905160-61905182 GCTGCTTCTGCTCATCAGAGTGG + Intronic
1141440947 16:84029237-84029259 GCTGCTTTTGGCCATCAGTGGGG + Intronic
1141531826 16:84651533-84651555 GCTGCTGTTGGTAAAGAGTGGGG + Intronic
1143021175 17:3917888-3917910 GCTGCTTGTGATGGGGAGTGGGG + Intergenic
1143425170 17:6830386-6830408 TCTGCTTTTGATCAGGAATTTGG - Exonic
1144020058 17:11233148-11233170 GCTGCTTTTACTCAGGAGTTTGG + Intergenic
1144632223 17:16880077-16880099 GATGCTTTTGATCCTGAGGTGGG - Intergenic
1146742593 17:35299488-35299510 GCTGTTTTTCATCAGGGGTGAGG - Intergenic
1148543814 17:48501724-48501746 GCTGGTTGTGATCATGAGAACGG - Intergenic
1150124038 17:62625332-62625354 ACTGCTTTTGATCTTGACTTTGG - Intergenic
1156234493 18:35188571-35188593 GCTGCTTTTAATTATAAGTGAGG + Intergenic
1156630744 18:38965314-38965336 GCTGCTTTTGATTATGCCAGTGG + Intergenic
1159300787 18:66564367-66564389 GATGCTTTTGAAAATGAATGGGG - Intronic
1160481202 18:79241059-79241081 GCTGCTTGTGGTCATGAGGGTGG + Intronic
1161162847 19:2770201-2770223 GCTGCTTCTGCTCATGTCTGTGG + Intronic
1164438650 19:28254366-28254388 GCTGCTTTTGAGGATGTGTTAGG + Intergenic
1165327845 19:35124670-35124692 GCTGCTTGTGCGCATGCGTGCGG - Exonic
937027756 2:118713343-118713365 GCTTCTTTGGATCTTCAGTGAGG - Intergenic
940260247 2:151771838-151771860 GCTGGTTTTACTCATGAGTTTGG + Intergenic
944017381 2:195058718-195058740 AGTGCTTTTGATCCTGAGTTCGG - Intergenic
944817604 2:203394225-203394247 GCTAGTATTGATCATCAGTGTGG + Intronic
945871430 2:215230955-215230977 GCTGCCTTTGACCAAGAGTATGG + Intergenic
948359770 2:237412041-237412063 GCTTCTCTCGACCATGAGTGAGG + Intronic
1172489285 20:35321981-35322003 GCTCCTTTTGAAGATGATTGTGG - Intronic
1173487442 20:43451687-43451709 GTTGCTTTTGAACATCAATGGGG - Intergenic
1175664467 20:60846287-60846309 GCAGCTTCTGATCACGTGTGTGG - Intergenic
1175903429 20:62368775-62368797 GCTGCTTTAGATCCCGTGTGAGG + Intergenic
1178121635 21:29475523-29475545 GCTGGATGTGATCATGAGGGTGG - Intronic
1178363680 21:31970541-31970563 GCTGCTCTCCATCATGAGTATGG - Intronic
953019593 3:39105039-39105061 GCTGCTCTCCATCATGAATGAGG + Intronic
953776373 3:45820799-45820821 CCTGATTTTGACCAGGAGTGGGG - Intergenic
957475921 3:80724102-80724124 GCTGCCTTGGAACATGATTGTGG - Intergenic
958659849 3:97052675-97052697 GCTGCTTTAGTTCCTGACTGGGG + Intronic
958681294 3:97335152-97335174 GCTTCATGAGATCATGAGTGTGG + Intronic
959187758 3:103068264-103068286 GCTGATTTTGATCATCATTTAGG - Intergenic
961471155 3:127113842-127113864 GCTGGTTTTCACCATGATTGTGG + Intergenic
961573298 3:127815952-127815974 GCTGCTTTGGATCCTGGGAGAGG + Intronic
964792424 3:160464606-160464628 GCTCCTTTTGCTCCTGAGAGAGG - Intronic
966307732 3:178555881-178555903 GCTAATTTTGATCAGGAGTTGGG + Intronic
968090595 3:195896084-195896106 GCGGCTTTTGAGCAGGAGTCCGG - Intronic
972463646 4:39330525-39330547 GCTGATTGTGGTCAAGAGTGTGG - Intronic
975198100 4:71550033-71550055 GCTGCTAGTGTTCATGATTGTGG + Intronic
975679136 4:76858341-76858363 GCTGGTTTTCACCATGACTGGGG - Intergenic
976208868 4:82647426-82647448 GCTGATATTGATCATGACGGTGG - Intronic
976222845 4:82771918-82771940 GCTGCTTTTGATCATGAGTGTGG - Intronic
978135827 4:105258036-105258058 GCTGCTTTTCATAATAAATGTGG + Intronic
982992811 4:162300508-162300530 GCTGCTCTTGATTAAGACTGTGG - Intergenic
983137902 4:164107472-164107494 GCTGCTTGGGATGCTGAGTGGGG - Intronic
985353440 4:189092151-189092173 AGTGGTTTTGATCATGAGTTTGG - Intergenic
986041770 5:4000728-4000750 ACTGCTTTTAGTCATGAGAGTGG + Intergenic
987455882 5:18146118-18146140 TCTTCTTGTGATGATGAGTGAGG - Intergenic
987524680 5:19031900-19031922 GCTGCTTTTTTTCCTGTGTGTGG - Intergenic
988993714 5:36694673-36694695 GCTGCTTTTGAGCATCGATGTGG + Intergenic
990501484 5:56400720-56400742 GCTGCTTTTGCTCAAGCTTGTGG - Intergenic
991109848 5:62887240-62887262 GCTGCTTATCATCATCACTGAGG - Intergenic
992150359 5:73896460-73896482 GAAGCTTTTAATCATGGGTGTGG + Intronic
992279448 5:75158856-75158878 GCTGCTTTTTATCCTGTGTATGG - Intronic
993352875 5:86871342-86871364 TCTGCTTTTGAACATGAATCTGG + Intergenic
993769036 5:91901602-91901624 GCTGCTTTTCACCATGAGGTAGG + Intergenic
996075741 5:119191705-119191727 GTTGCTTTTGATAATGCCTGTGG + Intronic
1000692460 5:164340541-164340563 CCTGCTTCTGAGCATGAGTTGGG + Intergenic
1002851738 6:1002999-1003021 GCTGACTTTGATCATGGCTGTGG - Intergenic
1004418486 6:15446740-15446762 GCTGATTTTGGTTATGAATGAGG + Intronic
1005804993 6:29466277-29466299 GCTGGTTTTCACCATGATTGTGG - Intergenic
1008569648 6:52804091-52804113 GATGCTTTTTTTCATGAGTTGGG + Intergenic
1012076746 6:94697197-94697219 GCTAGTTTTTACCATGAGTGTGG + Intergenic
1012301690 6:97596750-97596772 GCTGCTATTCCTCTTGAGTGGGG + Intergenic
1012472409 6:99587295-99587317 GCTGCTTTTTTTCAGAAGTGTGG - Intergenic
1017744371 6:157433724-157433746 TGTGCTTTGGATCATGAGTGGGG - Intronic
1017886268 6:158602018-158602040 GATGCTTATGATCTTGATTGTGG - Intronic
1018394982 6:163371243-163371265 GCTCCTTTTGATCAACAATGGGG + Intergenic
1020629581 7:10624444-10624466 GCAGTTTTAGACCATGAGTGAGG - Intergenic
1029277723 7:99417358-99417380 GCTTTTTTTGATCAAGGGTGGGG + Exonic
1030574331 7:111267051-111267073 GATGATTTTGATCATAAGTTTGG + Intronic
1031450372 7:121909901-121909923 GCTGCTTTCCATTATGAGTCTGG + Intronic
1036638134 8:10565298-10565320 GCTCCAGTTGAACATGAGTGTGG - Intergenic
1037480899 8:19304188-19304210 GCTGGTTTGGATCATGGGAGCGG - Intergenic
1039368638 8:36960951-36960973 GCTGCTTTGGATAAACAGTGTGG - Intergenic
1041591965 8:59598179-59598201 GCTTCTTCAGCTCATGAGTGTGG - Intergenic
1046185977 8:110718888-110718910 GCTGCTTTAGGTCATCATTGTGG + Intergenic
1046345891 8:112925971-112925993 GATGCTTTTCTTCATTAGTGGGG - Intronic
1047311012 8:123692018-123692040 GCTGTCTTTGATCATGACTCTGG + Intronic
1049765683 8:144354266-144354288 GCTGCTCTTCATCATCAGCGTGG - Exonic
1050077360 9:1878956-1878978 TCTGCTTTCTATCATGGGTGGGG - Intergenic
1050664769 9:7922965-7922987 GATGCTTTAGCTAATGAGTGAGG - Intergenic
1052393261 9:27906308-27906330 ACTGCTTAAGATCATGAATGAGG - Intergenic
1055662398 9:78518267-78518289 GCTGGTTTTAATCTTGATTGTGG - Intergenic
1059132029 9:111762662-111762684 ACAGCTTTTAATCATGAATGAGG - Intronic
1186334008 X:8566952-8566974 GCTGCCTTTGATCAGGACAGTGG - Intronic
1186753696 X:12647947-12647969 GCTGATTTTTATCCAGAGTGTGG - Intronic
1190072706 X:47292192-47292214 GCTCTTTTTCATCAGGAGTGAGG + Intergenic
1191713003 X:64172538-64172560 TTTGCTTTTTATCATGCGTGTGG - Intergenic
1192573112 X:72222325-72222347 TCTCCTTTTCATCAGGAGTGAGG - Intronic
1193597071 X:83459855-83459877 TCTTCTTTTGATGATGAATGTGG - Intergenic
1194969745 X:100330167-100330189 GCTGTTTTTAATCATTAATGAGG - Intronic
1199760717 X:150902249-150902271 GCTGATTTTGATCATGGGTGAGG - Intergenic