ID: 976224109

View in Genome Browser
Species Human (GRCh38)
Location 4:82781626-82781648
Sequence CTGGGCCACTACCCTTATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 85}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976224100_976224109 20 Left 976224100 4:82781583-82781605 CCACAGTGTTGGGAAGCAGGCCT 0: 1
1: 0
2: 5
3: 28
4: 352
Right 976224109 4:82781626-82781648 CTGGGCCACTACCCTTATGAAGG 0: 1
1: 0
2: 0
3: 10
4: 85
976224097_976224109 27 Left 976224097 4:82781576-82781598 CCCAGTGCCACAGTGTTGGGAAG 0: 1
1: 8
2: 60
3: 290
4: 751
Right 976224109 4:82781626-82781648 CTGGGCCACTACCCTTATGAAGG 0: 1
1: 0
2: 0
3: 10
4: 85
976224106_976224109 0 Left 976224106 4:82781603-82781625 CCTAATGGGAGGTGTTTGGGTTA 0: 7
1: 193
2: 786
3: 1746
4: 3344
Right 976224109 4:82781626-82781648 CTGGGCCACTACCCTTATGAAGG 0: 1
1: 0
2: 0
3: 10
4: 85
976224098_976224109 26 Left 976224098 4:82781577-82781599 CCAGTGCCACAGTGTTGGGAAGC 0: 1
1: 0
2: 9
3: 105
4: 483
Right 976224109 4:82781626-82781648 CTGGGCCACTACCCTTATGAAGG 0: 1
1: 0
2: 0
3: 10
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976224109 Original CRISPR CTGGGCCACTACCCTTATGA AGG Intronic
905525927 1:38639527-38639549 ATTGGCCATGACCCTTATGATGG + Intergenic
912853714 1:113148823-113148845 CTTAGCCATGACCCTTATGATGG + Intergenic
913574265 1:120154617-120154639 CTTGGCCACTACCATTAAGATGG + Exonic
914295536 1:146319420-146319442 CTTGGCCACTACCATTAAGATGG + Intergenic
914556575 1:148770201-148770223 CTTGGCCACTACCATTAAGATGG + Intergenic
914616259 1:149360029-149360051 CTTGGCCACTACCATTAAGATGG - Intergenic
920186008 1:204159915-204159937 CTTGGCCCCCACCCTTATCATGG + Intronic
920537226 1:206745882-206745904 CTGGGCCACAACCCTATTGTGGG + Intergenic
921356744 1:214291669-214291691 GTTGGCCACGACCCTTATGATGG + Intronic
924403939 1:243721564-243721586 GTTGGCCATAACCCTTATGATGG + Intronic
1064673586 10:17739695-17739717 CTGGGCCACTACCTCTTTGGTGG + Intergenic
1074267956 10:111924138-111924160 CTGACACTCTACCCTTATGAGGG + Intergenic
1078178233 11:8987040-8987062 CTGGCTAATTACCCTTATGATGG + Intronic
1080333068 11:31164039-31164061 CTGGACCACTATACTTATGTAGG + Intronic
1080989045 11:37507912-37507934 GTTGGCCATGACCCTTATGATGG + Intergenic
1082204853 11:49420874-49420896 GTTGGCCATGACCCTTATGATGG - Intergenic
1083859403 11:65411904-65411926 CTGGGCCACCACTCTGAGGAGGG + Exonic
1085880878 11:80464619-80464641 CTTGGCCACAACCACTATGAAGG + Intergenic
1085921071 11:80957647-80957669 CTGGGCCACTACCCTGACACTGG + Intergenic
1086650240 11:89279648-89279670 GTTGGCCATGACCCTTATGATGG + Intronic
1090186838 11:124744937-124744959 CTGGGCCTCTAGCCTTAGGTCGG + Intronic
1093031156 12:14289797-14289819 TTGGGCCACTAGCCTCAAGATGG - Intergenic
1093464626 12:19437385-19437407 GTTGGCCATGACCCTTATGATGG + Intronic
1101493674 12:105234102-105234124 CTTGGCCATCACCCTTAAGAGGG - Intronic
1110661861 13:78066349-78066371 CTGGCCCTCTGCCCTTGTGAGGG + Intergenic
1112923562 13:104645245-104645267 CAGGGCCAGAATCCTTATGAAGG - Intergenic
1113735987 13:112679463-112679485 CTGGGCCTCTTCCCTGAAGATGG + Exonic
1115166644 14:30455625-30455647 CAGGGCCAATGCCCTAATGAAGG - Intergenic
1117449479 14:55837052-55837074 GTTGGCCATGACCCTTATGATGG - Intergenic
1117748189 14:58892740-58892762 ATTGGCCATGACCCTTATGATGG - Intergenic
1120204135 14:81569398-81569420 CTGGGCCCTTACCCTTGAGATGG - Intergenic
1120849364 14:89155463-89155485 CTTGGACACTACCCTTCTGCTGG - Intronic
1124992683 15:34691576-34691598 ATTGGCCATGACCCTTATGATGG - Intergenic
1125152259 15:36546372-36546394 GTTGGCCATGACCCTTATGATGG - Intergenic
1141003231 16:80327698-80327720 CTGGGCCCCTTCCCTGAGGAGGG - Intergenic
1141029519 16:80575346-80575368 CTAGGCTTCTTCCCTTATGAAGG + Intergenic
1143268730 17:5659853-5659875 ATGGGCCACTACCCCTAAGAAGG - Intergenic
1145004252 17:19328568-19328590 GTGGGACAGTACCCTTTTGATGG + Intronic
1145273279 17:21415815-21415837 CTGGGCCACCACCATGAAGACGG - Exonic
1145293105 17:21565487-21565509 CTGGGAAAGTTCCCTTATGAGGG + Intronic
1145311468 17:21703259-21703281 CTGGGCCACCACCATGAAGACGG - Exonic
1147632210 17:41939366-41939388 TTGAGCCACTACCCTTTTGGTGG - Intronic
1151532915 17:74718902-74718924 CTGGACTACTACCTTTATTAGGG + Intronic
1155849451 18:30752745-30752767 CTGGTCCACAAGCCTTCTGAAGG - Intergenic
1161391127 19:4020996-4021018 CTGGGAAACTACCCTTATAAAGG - Intronic
1167826401 19:51977574-51977596 CTGGGCCACAATCCTGAAGAGGG + Intronic
929040283 2:37737998-37738020 CTGTGCCTCTACCCTAATAATGG + Intronic
930939463 2:56997256-56997278 CTTGGCCACAACCACTATGAAGG - Intergenic
932430334 2:71670341-71670363 CTGCCCCACTGCCCTTTTGAAGG - Intronic
935171156 2:100612447-100612469 CTGGGCCTGTGCCCTCATGAGGG + Intergenic
937946107 2:127338985-127339007 CTGGTCGACTGGCCTTATGAAGG + Exonic
938249556 2:129804049-129804071 CTTAACCACTACCCTAATGACGG + Intergenic
938259109 2:129882662-129882684 CTGGGCCACTTCTGTCATGACGG - Intergenic
938510465 2:131936829-131936851 CTGGGCCTCTGGGCTTATGATGG + Intergenic
938948786 2:136238554-136238576 GAGGGCCACTACTCTTACGATGG + Intergenic
945911473 2:215654927-215654949 ATTGACCACTACCCTTATGAAGG - Intergenic
946531761 2:220578096-220578118 CTGGGCCACTTCCCTTCTTTTGG + Intergenic
947795561 2:232891900-232891922 CTGGGCCACAGCGCTGATGAGGG + Intronic
948135482 2:235633103-235633125 GTGGGCCATGACCCTTATGATGG - Intronic
1176783363 21:13226497-13226519 CTGGGCCTCTGGGCTTATGAAGG - Intergenic
1180994039 22:19955684-19955706 CTGGGCCACCAGCCCTGTGAGGG + Intronic
951220690 3:20066064-20066086 CTGGGCCACACTCCTTTTGAAGG + Intronic
952726950 3:36596601-36596623 CTGGGCCCCTCCCCTCATGTTGG + Intergenic
962979333 3:140473633-140473655 CAGGGCCACATCCCTTCTGAAGG - Intronic
963812901 3:149797105-149797127 GTTGGCCATGACCCTTATGATGG - Intronic
965371713 3:167870934-167870956 GTTGGCCATGACCCTTATGACGG - Intergenic
967255746 3:187590145-187590167 TTGAGCCATTACCCTTATTAGGG + Intergenic
970895046 4:21092627-21092649 TTGGCTCTCTACCCTTATGAAGG - Intronic
974394628 4:61318685-61318707 CAGAGCCATTACCCTGATGAAGG - Intronic
976224109 4:82781626-82781648 CTGGGCCACTACCCTTATGAAGG + Intronic
979703093 4:123689592-123689614 CTAGGCCTCTGCCCCTATGATGG + Intergenic
986212843 5:5690267-5690289 GTCGGCCATGACCCTTATGATGG - Intergenic
996576662 5:124983511-124983533 GTTGGCCATGACCCTTATGATGG + Intergenic
1005451034 6:25972621-25972643 CTGGGCCACTGCCACTAAGATGG - Intronic
1006081494 6:31570163-31570185 ATTGGCCATAACCCTTATGATGG + Intergenic
1006393427 6:33772117-33772139 CTGGGCCTCTATCCTGAAGAGGG - Exonic
1006813654 6:36836981-36837003 CTGGGTCAATACCCTTTTGGGGG - Intronic
1011835026 6:91421261-91421283 CTGGGCCTTTACGCTTGTGATGG - Intergenic
1025871870 7:65441795-65441817 ATGGGCCACCTCCTTTATGAAGG - Intergenic
1026291523 7:69010664-69010686 CTGGGCCACAACCTCTATCATGG - Intergenic
1036911320 8:12759577-12759599 AAGGGCCACTACCCTTACAAAGG + Intergenic
1039847234 8:41334233-41334255 CTGAGACCCTACCCTTACGAGGG + Intergenic
1040825879 8:51620038-51620060 ATCGGCCATCACCCTTATGATGG + Intronic
1041869747 8:62619219-62619241 CTGGGTCACTTACCTTAAGAAGG + Intronic
1042940358 8:74100992-74101014 CAGGGCCACACCCCTTCTGACGG - Intergenic
1045291083 8:100833512-100833534 GTCGGCCATGACCCTTATGATGG + Intergenic
1047630250 8:126699336-126699358 CTGGGCCTCTAGGCCTATGATGG - Intergenic
1049470275 8:142772224-142772246 CTGGGCATCTACCCCCATGAAGG + Intronic
1049864048 8:144922175-144922197 CTGGGCCACAACCCTTTCAAGGG + Intergenic
1050778624 9:9301408-9301430 CTGTGCCACCATCTTTATGATGG - Intronic
1056214683 9:84396003-84396025 CTTGGCCAGTACCCCTAGGAGGG + Intergenic
1056827989 9:89890164-89890186 CAGGGCTACTACCCATCTGAGGG - Intergenic
1061026946 9:128055839-128055861 CTGGGCCTCTACCCCTAAGACGG - Intergenic
1191846288 X:65550324-65550346 CTGGGCCACCACTCTGAGGAGGG - Intergenic
1194011697 X:88569714-88569736 CTGGGCAACATCACTTATGATGG - Intergenic
1198226491 X:134650290-134650312 GTCGGCCATGACCCTTATGATGG + Intronic