ID: 976226766

View in Genome Browser
Species Human (GRCh38)
Location 4:82800337-82800359
Sequence TGCTGGGTATGGGGAGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976226766_976226773 -3 Left 976226766 4:82800337-82800359 CCCTCTGCTCCCCATACCCAGCA No data
Right 976226773 4:82800357-82800379 GCAGACCTTCCTACTCCCTGTGG No data
976226766_976226779 29 Left 976226766 4:82800337-82800359 CCCTCTGCTCCCCATACCCAGCA No data
Right 976226779 4:82800389-82800411 TCAGACTGTCCTTTCTCTCTGGG No data
976226766_976226778 28 Left 976226766 4:82800337-82800359 CCCTCTGCTCCCCATACCCAGCA No data
Right 976226778 4:82800388-82800410 TTCAGACTGTCCTTTCTCTCTGG No data
976226766_976226780 30 Left 976226766 4:82800337-82800359 CCCTCTGCTCCCCATACCCAGCA No data
Right 976226780 4:82800390-82800412 CAGACTGTCCTTTCTCTCTGGGG 0: 1
1: 0
2: 0
3: 31
4: 330

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976226766 Original CRISPR TGCTGGGTATGGGGAGCAGA GGG (reversed) Intergenic
No off target data available for this crispr