ID: 976231138

View in Genome Browser
Species Human (GRCh38)
Location 4:82844393-82844415
Sequence CTGTGGATAAGGTGGTACCT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 1, 2: 1, 3: 27, 4: 148}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976231138 Original CRISPR CTGTGGATAAGGTGGTACCT GGG Exonic
902112785 1:14096969-14096991 CAGTGGTTAAGGTGGAGCCTAGG + Intergenic
902955476 1:19922055-19922077 CTGTGGGTAGGGAGATACCTGGG + Intronic
903480004 1:23646045-23646067 CTCTGCAGAATGTGGTACCTTGG - Intergenic
904677728 1:32208615-32208637 GTGTGGCTAAGGAGTTACCTGGG + Exonic
906162388 1:43659935-43659957 CTGTGGATATGTAGGGACCTTGG + Intronic
906547671 1:46632615-46632637 CTGTGTATAACTTGGTATCTTGG + Intergenic
910330664 1:86069122-86069144 CTGTGGCCAAGCTGGTACATAGG - Intronic
913161206 1:116147579-116147601 CAGTGGAGAAGGTTGTACTTAGG - Intergenic
913287030 1:117235976-117235998 CTGTGGATAAGGTTGCACGTGGG + Intergenic
915219425 1:154362480-154362502 CTGAGGACAAGGTGGTCCCAAGG - Intergenic
915693644 1:157716339-157716361 CTGTGGCCGAGCTGGTACCTAGG + Intergenic
917150153 1:171934667-171934689 CTGGGGATGTGGTGGCACCTGGG + Intronic
917246327 1:173004944-173004966 CTGTGGCTAAACTGGTACCTAGG + Intergenic
918353100 1:183678072-183678094 ATGTGGATGAGGTGGAACTTTGG + Intronic
918989941 1:191685159-191685181 CTGTGGCTGAGCTGGTACCTAGG + Intergenic
919192901 1:194246681-194246703 CTGTGGAGCAAGTGGGACCTGGG - Intergenic
919336625 1:196244348-196244370 CTGTGACCAAGCTGGTACCTGGG - Intronic
920953644 1:210597822-210597844 CTGTGGGTGAGCTGATACCTTGG + Intronic
1064446590 10:15399167-15399189 CTGTGGCTGAGCTGGTACCTAGG - Intergenic
1066142973 10:32526409-32526431 CTGTGGTTGAGCTGATACCTAGG + Intronic
1066366068 10:34777956-34777978 CCGTGGATGTGGTGGTAACTTGG - Intronic
1067471015 10:46537735-46537757 GAGTGGAGGAGGTGGTACCTAGG + Intergenic
1070795611 10:79214667-79214689 CTCTGGAGCAGGTGGTTCCTGGG + Intronic
1077170922 11:1165384-1165406 CTGTGGAGTAGGTGGCCCCTGGG - Exonic
1077659563 11:4055538-4055560 CCGTGGATGAGGTGGTACAGTGG + Exonic
1078012825 11:7586692-7586714 CTGCAGAGAAGGTGGTCCCTTGG + Intronic
1078014389 11:7600677-7600699 CTGTAGATAAGGTGCTTCCTCGG + Intronic
1079069241 11:17328797-17328819 TTGTGGCTGAGCTGGTACCTAGG + Intronic
1079974469 11:27075002-27075024 ACGTGGCTAATGTGGTACCTTGG + Intronic
1081461045 11:43273286-43273308 CTGTGGAAAAGGTGGCCCATGGG - Intergenic
1089777116 11:120845911-120845933 CATTGGGTAGGGTGGTACCTTGG - Intronic
1090099462 11:123778790-123778812 CTGTGGGTAATGAGGTTCCTGGG + Intergenic
1090929240 11:131280423-131280445 CTGTGGATAATGTGAGACATAGG + Intergenic
1092489135 12:8929377-8929399 CTGTGGATAAGGAGGTAGGAAGG - Intronic
1096343954 12:50828761-50828783 CTGTGGCCGAGCTGGTACCTCGG + Intergenic
1097899259 12:64857089-64857111 CTGTGGCTGAGCTGGTATCTAGG + Intronic
1106156378 13:27161124-27161146 GGATGGTTAAGGTGGTACCTTGG - Intronic
1106656384 13:31751709-31751731 GTGGAGAGAAGGTGGTACCTTGG - Intronic
1110915173 13:81012172-81012194 TTGTGGTCAAGCTGGTACCTAGG + Intergenic
1113253938 13:108486497-108486519 CTGTGGTCAAGCTGGTATCTAGG - Intergenic
1114783734 14:25570149-25570171 CTGTGGTTGAGCTGGTACCTAGG + Intergenic
1114834218 14:26184523-26184545 ATGTGGGAAAGGTGGTACCAGGG - Intergenic
1118547319 14:66906029-66906051 CTGGGGATAATGTGTCACCTAGG - Intronic
1118595188 14:67429988-67430010 CTGTGGAGCAGATGGTACCCAGG + Intergenic
1121349695 14:93163465-93163487 CTTTGGATCAGGTGGGATCTAGG - Intergenic
1121736292 14:96220375-96220397 GTGTGGATAAGCTCGTGCCTAGG - Intronic
1122671126 14:103373241-103373263 CTGTGGATCTGGTTTTACCTGGG - Intergenic
1122719168 14:103712601-103712623 CTGTGTTTTGGGTGGTACCTCGG - Intronic
1122740981 14:103871604-103871626 CTGGGGAGAAGGTGCTCCCTGGG + Intergenic
1125878265 15:43168571-43168593 CTGTGGCTGAGCTGGTACCCAGG + Intronic
1127774795 15:62256243-62256265 GTGGGGATGAGGTGGAACCTGGG + Intergenic
1127775389 15:62260469-62260491 GTGGGGATGAGGTGGAACCTGGG + Intergenic
1133283842 16:4681495-4681517 CTGGGGAGCAGGTGGTCCCTGGG + Intronic
1136418419 16:30117286-30117308 CTGTGGATAAGGAGGTGACTTGG + Intronic
1145888647 17:28399487-28399509 CTGTGGATGGGGTGGTGCCTTGG + Exonic
1146585311 17:34077081-34077103 CTGTGAGTAAGGGAGTACCTGGG + Intronic
1148333517 17:46826204-46826226 CTGTGGAGAAGGTGGTTAGTTGG - Intronic
1148662859 17:49349504-49349526 TTGTAGATAAGGTAGTACTTGGG - Intronic
1149806240 17:59620201-59620223 CTGTGGAGAAGGTGGTAGGAAGG + Intronic
1152274015 17:79343639-79343661 CCGTGGATCAGGTGTCACCTGGG + Intronic
1152988463 18:340877-340899 CTGTGGACAAGGTGCTTCCAAGG - Intronic
1153695350 18:7634737-7634759 CTGTGTAAAAGGTGATAACTAGG - Intronic
1153715047 18:7839181-7839203 CTGTGCCCGAGGTGGTACCTAGG + Intronic
1154057562 18:11025940-11025962 CTGAGGATTAGGTGATTCCTGGG - Intronic
1155243645 18:23886791-23886813 TTATGGATAAGGTGGGACTTTGG + Intronic
1157928732 18:51795474-51795496 CTGTGGATAAGGGGGAACTATGG - Intergenic
1158431280 18:57389736-57389758 CTGTGGCCAACCTGGTACCTAGG - Intergenic
1160382965 18:78474783-78474805 ATGTGCATAGTGTGGTACCTGGG - Intergenic
1160917879 19:1506397-1506419 CTGAGGGTCAGGTGGGACCTCGG + Intronic
1163129235 19:15262050-15262072 CTGTGGATCAGGGGCTGCCTTGG - Intronic
1168228620 19:55014641-55014663 CTGTGGATGACATGGTACCCTGG - Exonic
1168245768 19:55112568-55112590 CCGTGGCTCAGGAGGTACCTGGG + Exonic
1168524904 19:57081035-57081057 CTGTGGATGAGGTGGTTCCAGGG + Intergenic
927461941 2:23306848-23306870 CTGTGGACAAGGTGACTCCTAGG - Intergenic
930092742 2:47543153-47543175 CTGTGAATAAGGAGCTACCAGGG + Intronic
930244695 2:48971232-48971254 TGATTGATAAGGTGGTACCTGGG - Intronic
930878299 2:56244562-56244584 CTGTGGATAAGCTGGTACCTAGG + Intronic
933156148 2:78977972-78977994 CTGTGTAGAAGGTGGATCCTGGG - Intergenic
933671071 2:85007669-85007691 CTGAGGACACAGTGGTACCTGGG - Intronic
938077572 2:128347912-128347934 CTGTGGCTGAGGTGGTAGCTGGG - Intergenic
938177933 2:129153208-129153230 CTGTGGCTGAGCTGGTACCTAGG + Intergenic
939435388 2:142170278-142170300 ATGTGGATGAGGTGGTGCTTTGG - Intergenic
943485450 2:188473771-188473793 CTGTGGCTGAGCTGGTATCTAGG + Intronic
943600793 2:189918931-189918953 CTGTGGATAAGGGGGGACTATGG - Intronic
945088500 2:206157906-206157928 ATTGGGATAGGGTGGTACCTTGG - Intronic
1169618016 20:7471686-7471708 CTGTGGCTAAGCTAGTATCTAGG + Intergenic
1169746174 20:8945371-8945393 TTGAAGAAAAGGTGGTACCTGGG + Intronic
1170219323 20:13925406-13925428 CTGTGGTTAAGGTTTTACCAGGG + Intronic
1170668391 20:18406696-18406718 CTGTGTTCAAGCTGGTACCTAGG - Intronic
1170825001 20:19786128-19786150 CTCTTGATAAGGAGGTGCCTAGG - Intergenic
1177923608 21:27185872-27185894 CTATGAATGAGGTAGTACCTTGG + Intergenic
1179236713 21:39553982-39554004 CTGTGGATATGGAGTGACCTGGG - Intergenic
1183497202 22:38153750-38153772 CTGTAGCTGAGCTGGTACCTAGG - Intronic
1184731721 22:46374373-46374395 TTCTGGAAAAGGTGGTACATTGG - Intronic
949448528 3:4161797-4161819 CTGTGGCTGAGCTGGCACCTGGG + Intronic
950011290 3:9725882-9725904 CTGGGGGTAAGGTGTTCCCTTGG + Intronic
953406129 3:42660671-42660693 CTGTGGAGAAAGTGTTACCCGGG + Intronic
955187880 3:56732491-56732513 CTGTGGATAAAGAGGTCCCCAGG + Intronic
956222981 3:66923697-66923719 CTGTGGCCAAGCTGGTACCTAGG - Intergenic
957192208 3:77023674-77023696 GTGTTGATAAGGAGGTACTTAGG - Intronic
957672531 3:83324090-83324112 CTGTGGCTGAGCTGGTACCCAGG + Intergenic
957976116 3:87447449-87447471 CTGGGGCTGAGCTGGTACCTAGG + Intergenic
962957709 3:140281412-140281434 CTGTGGGGCAGCTGGTACCTGGG + Intronic
963109890 3:141679529-141679551 ATGTGGAAAAGTTGGAACCTTGG + Intergenic
963330547 3:143910281-143910303 CTGTGGCCTAGTTGGTACCTAGG - Intergenic
963354827 3:144197856-144197878 CTGTGGCAGAGCTGGTACCTAGG + Intergenic
966739742 3:183221566-183221588 CTGTGGGAAAGCTGGAACCTAGG + Intronic
969032556 4:4226530-4226552 CTGTGGATGCTGTGGTACGTGGG - Exonic
970211035 4:13710225-13710247 CTGTGGGTAAGGTTGAGCCTGGG + Intergenic
971701602 4:29984587-29984609 CTGTGGCTTAGCTGGTATCTAGG - Intergenic
972353432 4:38259015-38259037 CTGGGCATCAGGTCGTACCTGGG + Intergenic
972709657 4:41582268-41582290 CCGTGGATCAGGTGGTGCCAAGG + Intronic
973287828 4:48439710-48439732 CTGTGGCTGAGCTGGTACCCAGG + Intergenic
974257493 4:59478541-59478563 CTAGGGATAAGTTGATACCTGGG - Intergenic
974741237 4:66010817-66010839 CTGTGAATCAGGTAGTTCCTAGG + Intergenic
975629779 4:76388227-76388249 CTGTGGCTGAGCTGGTACCTAGG - Intronic
976231138 4:82844393-82844415 CTGTGGATAAGGTGGTACCTGGG + Exonic
976634334 4:87272754-87272776 CTGTGGATACAGTGGTAAATAGG + Intergenic
978934601 4:114359489-114359511 CTGTGGCTGAGCTGGTACCTGGG + Intergenic
979191803 4:117870204-117870226 CTGAAGATAAGATGGTATCTGGG - Intergenic
979305658 4:119140018-119140040 CTGTTGTTAATGTGGTACCAGGG + Intronic
980172396 4:129305739-129305761 CTGTGGCCAAGCTGGTACCTAGG + Intergenic
981471577 4:145141407-145141429 CAGTGAATAAGGTGGTACAATGG + Exonic
982977015 4:162076624-162076646 CTGTGGATAAAGTGGATGCTGGG + Intronic
990217740 5:53552776-53552798 TTTTGGATAAGGTGGTATGTTGG + Intergenic
993509878 5:88757984-88758006 GTGTAGCTAAGGTGGTAGCTGGG - Intronic
997701343 5:135902245-135902267 CTGTGGATACGGTGGGTCCTGGG + Intergenic
1003390227 6:5707323-5707345 CTGAGAATAAAGTGGTACCAGGG + Intronic
1003625260 6:7735650-7735672 CTGTGGGGCAGGGGGTACCTGGG - Intronic
1004508578 6:16266365-16266387 CTGTGAAAAAGGTGGCACGTCGG + Intronic
1004508583 6:16266418-16266440 CTGTGAAAAAGGTGGCACGTCGG + Intronic
1005157056 6:22819229-22819251 CTGTGGTTGAGCTGGTACCTAGG + Intergenic
1008642028 6:53474030-53474052 CTGTAGCTGATGTGGTACCTAGG + Intergenic
1008822537 6:55651035-55651057 CTGTGGCCAAGTTGGAACCTAGG + Intergenic
1012546798 6:100428997-100429019 CTGTGGATAAGGGGGGACTATGG + Intronic
1012892118 6:104908376-104908398 CTGTGGCTGAGCTGGTACCTAGG - Intergenic
1014384598 6:120785617-120785639 CTGTGGAGCAGGCGGGACCTGGG + Intergenic
1016623810 6:146142889-146142911 CTGTGGCCAAGCTGGTACTTAGG + Intronic
1017504263 6:155053285-155053307 TTCTGGATAAGGGGGTACGTGGG + Intronic
1017924814 6:158901618-158901640 CTGTGGCCTAGGTGGTACCTAGG + Intronic
1019519934 7:1456038-1456060 CTCTGGATGAGGTGGTGGCTGGG - Intronic
1021537773 7:21724696-21724718 CTGTGGATATGGGAGTAACTGGG + Intronic
1022749927 7:33213831-33213853 CAGTGGCTAAGGTGGTATCCAGG + Intronic
1022804163 7:33805164-33805186 CTGTGGATTGGGAGGTGCCTAGG - Intergenic
1024319441 7:48050268-48050290 CTGTGGTGAGGGTGGTATCTTGG - Intronic
1026867616 7:73833214-73833236 CAGTGGACAAGGTGATACCTTGG - Intergenic
1029839644 7:103348264-103348286 CTGTGGAGAAGTTGGTGGCTGGG - Intronic
1030723559 7:112898446-112898468 CTGTGGCTGGGCTGGTACCTGGG - Intronic
1031472424 7:122182743-122182765 CTGTGGTCAAGCTGATACCTAGG - Intergenic
1031905759 7:127458285-127458307 CTGTGGCTGAGCTGGTACCTAGG - Intergenic
1035416827 7:158696141-158696163 CTGTGCTTAAGGTGGCAGCTGGG + Intronic
1036553023 8:9831875-9831897 CTCTGGATAATGGGTTACCTGGG - Intergenic
1038693940 8:29788399-29788421 CTGTGGAGAAGGAGGCGCCTAGG - Intergenic
1040617686 8:49055128-49055150 CTGTGGATCAGTTGGTTTCTGGG + Intronic
1040939646 8:52819108-52819130 CTGCTGCTCAGGTGGTACCTGGG + Intergenic
1041853909 8:62426907-62426929 ATGTGGATAAGGTGGAAACATGG + Intronic
1042898393 8:73695608-73695630 CTGTGGCTGAGCTGGTACCTAGG - Intronic
1043600335 8:81929422-81929444 ATGTGGATGAGCTGGTACCTAGG - Intergenic
1044627406 8:94247532-94247554 CTGTGTATAGGATGATACCTGGG + Intergenic
1048645948 8:136419272-136419294 CTGTGAATGAGGTGGACCCTTGG + Intergenic
1049320903 8:141995741-141995763 TTGTGGGCAAGGTGGTTCCTTGG + Intergenic
1050145204 9:2560158-2560180 CTGTGGCCAAGCTGGTACCTAGG - Intergenic
1050236371 9:3585286-3585308 CTGTGGAGATGGTAGTAACTGGG - Intergenic
1050248186 9:3713842-3713864 CTGTGGCCAAGCTGGTACATAGG - Intergenic
1187588482 X:20689965-20689987 CTGTGGATGAGCTGGTACCTAGG + Intergenic
1190260018 X:48791721-48791743 CTGTGGAAAAGCTGGGAACTTGG + Intronic
1190948600 X:55120126-55120148 CTGTGGAGAATTTGTTACCTAGG - Intronic
1191048856 X:56169345-56169367 CTGTGGCCAAGCTGGTACCTAGG - Intergenic
1193812228 X:86065573-86065595 GTGTTGATAAGGTGCTACTTTGG + Intergenic
1193914662 X:87350815-87350837 CAGTGGATAAGGTGACTCCTTGG + Intergenic
1194219612 X:91175127-91175149 CTGTGGCTGAGCTGCTACCTAGG + Intergenic
1194291063 X:92072287-92072309 CTGTGGCCAAGCTGGTACCTAGG + Intronic
1194889775 X:99364363-99364385 CTGTGGCTGAGCTGGTATCTTGG - Intergenic
1195543367 X:106087820-106087842 CTGTGGATGGGCTGGTACCCAGG + Intergenic
1197072930 X:122322172-122322194 CTGTGGCCAAGTTGGTACCTAGG - Intergenic
1200369978 X:155715073-155715095 CTGTGGCTGAGCTAGTACCTGGG + Intergenic
1200556123 Y:4638891-4638913 CTGTGGCTGAGCTGCTACCTAGG + Intergenic
1200608572 Y:5296862-5296884 CTGTGGCCAAGCTGGTATCTAGG + Intronic