ID: 976232069

View in Genome Browser
Species Human (GRCh38)
Location 4:82854856-82854878
Sequence CTGCATTTACATACGTGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 64}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976232069_976232073 10 Left 976232069 4:82854856-82854878 CCCTGCCACGTATGTAAATGCAG 0: 1
1: 0
2: 0
3: 2
4: 64
Right 976232073 4:82854889-82854911 AGCACATCTCTTACCACAAAGGG 0: 1
1: 0
2: 0
3: 15
4: 125
976232069_976232075 26 Left 976232069 4:82854856-82854878 CCCTGCCACGTATGTAAATGCAG 0: 1
1: 0
2: 0
3: 2
4: 64
Right 976232075 4:82854905-82854927 CAAAGGGCTGAAAATTCATCCGG 0: 1
1: 0
2: 1
3: 18
4: 340
976232069_976232072 9 Left 976232069 4:82854856-82854878 CCCTGCCACGTATGTAAATGCAG 0: 1
1: 0
2: 0
3: 2
4: 64
Right 976232072 4:82854888-82854910 AAGCACATCTCTTACCACAAAGG 0: 1
1: 0
2: 0
3: 18
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976232069 Original CRISPR CTGCATTTACATACGTGGCA GGG (reversed) Intronic
903394041 1:22985770-22985792 CTGCATTTGTTTCCGTGGCAGGG + Intergenic
918170779 1:181995359-181995381 CTGCATTCACATCCTTGTCATGG - Intergenic
924635916 1:245787775-245787797 CTGCATTTTCATCCGTGGGAAGG + Intronic
1066086895 10:31979931-31979953 CTGCATTACCATACCTGGCTGGG - Intergenic
1066181459 10:32965295-32965317 CTATATGTACATACGTGGAAAGG + Intronic
1070963293 10:80514310-80514332 CTGCATTTAAAGAGGTGGGATGG + Intronic
1080132313 11:28811230-28811252 CTGAGCTTCCATACGTGGCAAGG + Intergenic
1080215816 11:29839107-29839129 CTCCATTTACACATATGGCAAGG + Intergenic
1100159399 12:91840830-91840852 CTGAATTTACATACCAGGTATGG + Intergenic
1104129021 12:125874742-125874764 CTGCAGCTACATGGGTGGCAGGG - Intergenic
1104479598 12:129096088-129096110 CTGCATGTGCATACCTGGGAAGG - Intronic
1109443173 13:62400564-62400586 CTGCACTTAGAGAGGTGGCAAGG + Intergenic
1111023614 13:82488923-82488945 GTTCATTTACATATGTGTCATGG + Intergenic
1119567423 14:75640660-75640682 CAGCATTTACAGAAGGGGCAAGG - Intronic
1122144318 14:99680200-99680222 CTGCCTTTACATGGGTGGCCTGG - Exonic
1125174084 15:36800286-36800308 CTGCAAATACAGACCTGGCAAGG + Intronic
1128197803 15:65775917-65775939 CTGAATTTGCAAAGGTGGCATGG - Intronic
1133846584 16:9459813-9459835 AAGAATTTACATATGTGGCAGGG - Intergenic
1135469792 16:22719998-22720020 CTGAATTTGCAAACGTGACATGG - Intergenic
1137744335 16:50809842-50809864 CGGCATTTACCTATGGGGCAAGG - Intergenic
1150051526 17:61969051-61969073 CTGCATTTAAATTTTTGGCATGG + Intronic
1153786245 18:8537655-8537677 GTGCATTGACCCACGTGGCAAGG + Intergenic
1156787143 18:40929186-40929208 CTCCATTTTCATACTTGGAAGGG - Intergenic
1159536794 18:69725248-69725270 CTGCAGTCACATACTTGGCTGGG + Intronic
1160381233 18:78457678-78457700 CTGCTTTTACATAGAAGGCAAGG - Intergenic
1161681566 19:5682258-5682280 CTGCATTGACAGAAGAGGCAGGG + Intronic
1165709888 19:38003586-38003608 CTGTAAATACAGACGTGGCAGGG + Intronic
1166946363 19:46399305-46399327 CTGCATTTTCATTGGTTGCAGGG + Intergenic
927953650 2:27192025-27192047 CTACATTTTCATATATGGCAGGG - Intergenic
933452736 2:82477499-82477521 CTGCATTTAGGTACGTAGGAGGG + Intergenic
942357371 2:175132572-175132594 CTGAACTTAGATACCTGGCAAGG - Intronic
1173185303 20:40835927-40835949 AGGCATTTAGATACCTGGCATGG + Intergenic
1173503715 20:43571272-43571294 ATGCATGTACATAGGGGGCAGGG + Intronic
1175677817 20:60961879-60961901 CTGCATTTTCCTACCTGACAAGG - Intergenic
953107128 3:39894171-39894193 ATGCATTTACATGCATGTCATGG - Intronic
953311436 3:41883942-41883964 CTCCATTTACAGACGGGCCAAGG - Exonic
957764664 3:84607492-84607514 CTCCTTATACATAAGTGGCATGG + Intergenic
960214911 3:115020664-115020686 CTAGATTTACATATGAGGCAGGG - Intronic
962898114 3:139734112-139734134 CAGCATTTACATATATGCCAGGG + Intergenic
962928779 3:140018732-140018754 CTGCATTTCCAAACGAGGGAGGG + Intronic
964689362 3:159432698-159432720 CTGCATATACATGCCTGGGAAGG + Intronic
967330802 3:188287295-188287317 CTGCATTAACACACGGGGCGGGG - Intronic
970114727 4:12681881-12681903 CTGCATTGAGATACTTGGAAGGG + Intergenic
976035439 4:80813767-80813789 CTGTATTTACACATTTGGCAAGG - Intronic
976232069 4:82854856-82854878 CTGCATTTACATACGTGGCAGGG - Intronic
981326610 4:143455673-143455695 CTGAATTTACAGATGTGGCTTGG - Intronic
985905464 5:2831588-2831610 CTGCAGGTGCAGACGTGGCAGGG + Intergenic
999315829 5:150583385-150583407 CTGCATTTCCTGACGTGGCCAGG - Intergenic
1004133101 6:12939978-12940000 CCGCATTTACCTAGCTGGCAAGG - Intronic
1005591242 6:27330410-27330432 CTCCATTTACATAAGTTGTAAGG + Intergenic
1008401706 6:51070844-51070866 CTGCATTGAAATGCCTGGCAAGG + Intergenic
1024587727 7:50856061-50856083 CTGCATTTGCATTCATGGCCTGG - Intergenic
1028667168 7:93359802-93359824 GTGCATTTACAGACATCGCAGGG - Intronic
1034254610 7:149717682-149717704 CTGCATCTACACCCCTGGCAAGG - Intronic
1038219891 8:25597304-25597326 CTGCATTAACCTACGTCCCAAGG - Intergenic
1047825695 8:128571996-128572018 AGGCATGTACAAACGTGGCACGG - Intergenic
1055633329 9:78247409-78247431 ATGTAGTTACATAGGTGGCAGGG + Intronic
1057282932 9:93725905-93725927 TCTCATTTACATACCTGGCAGGG + Intergenic
1057882150 9:98800583-98800605 CTGTATTTACCTACATGGAAAGG - Intergenic
1058705371 9:107633625-107633647 CTGGATTTACAAAGGTGGAAAGG + Intergenic
1060602520 9:124887735-124887757 CTGCATTTATATAGGTGGAAAGG + Intronic
1203557515 Un_KI270744v1:13129-13151 CTGCATTTAGAAAGGAGGCAGGG - Intergenic
1186250133 X:7656816-7656838 CTTTATTTCCATACATGGCAGGG + Intergenic
1186765992 X:12771216-12771238 CAGCATTTACATCCGTGCAATGG + Intergenic
1195581448 X:106508102-106508124 GTGCATTTAAATCCGTGGCTGGG + Intergenic
1201753653 Y:17462725-17462747 CTGTTTTTACATACGTAACATGG + Intergenic
1201847900 Y:18443258-18443280 CTGTTTTTACATACGTAACATGG - Intergenic