ID: 976236307

View in Genome Browser
Species Human (GRCh38)
Location 4:82900870-82900892
Sequence TCTCCTTCCACCAGTGCGTA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 82}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976236299_976236307 10 Left 976236299 4:82900837-82900859 CCCGTGACACCGTGCTCAGCCGG 0: 1
1: 0
2: 0
3: 9
4: 167
Right 976236307 4:82900870-82900892 TCTCCTTCCACCAGTGCGTATGG 0: 1
1: 0
2: 0
3: 6
4: 82
976236298_976236307 28 Left 976236298 4:82900819-82900841 CCGCAGTGGGCTGCAGCACCCGT 0: 1
1: 0
2: 2
3: 18
4: 242
Right 976236307 4:82900870-82900892 TCTCCTTCCACCAGTGCGTATGG 0: 1
1: 0
2: 0
3: 6
4: 82
976236304_976236307 1 Left 976236304 4:82900846-82900868 CCGTGCTCAGCCGGGAGCGCGGC 0: 1
1: 0
2: 0
3: 10
4: 133
Right 976236307 4:82900870-82900892 TCTCCTTCCACCAGTGCGTATGG 0: 1
1: 0
2: 0
3: 6
4: 82
976236305_976236307 -9 Left 976236305 4:82900856-82900878 CCGGGAGCGCGGCCTCTCCTTCC 0: 1
1: 0
2: 0
3: 21
4: 184
Right 976236307 4:82900870-82900892 TCTCCTTCCACCAGTGCGTATGG 0: 1
1: 0
2: 0
3: 6
4: 82
976236301_976236307 9 Left 976236301 4:82900838-82900860 CCGTGACACCGTGCTCAGCCGGG 0: 1
1: 0
2: 0
3: 10
4: 85
Right 976236307 4:82900870-82900892 TCTCCTTCCACCAGTGCGTATGG 0: 1
1: 0
2: 0
3: 6
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976236307 Original CRISPR TCTCCTTCCACCAGTGCGTA TGG Exonic
900587610 1:3440639-3440661 TCTCCTTACACAAATGCGAAGGG - Intergenic
902439710 1:16421499-16421521 TCTTCCTCCACCAGTAAGTAGGG - Exonic
903678628 1:25082587-25082609 GCTCCTTCCAGCAGTGGGTTTGG - Intergenic
904423192 1:30407282-30407304 TCTCCTTCCATCAGTGCATCTGG - Intergenic
904862131 1:33546371-33546393 TGTTCTTCCACCATTGCATATGG - Intronic
915268002 1:154732442-154732464 TCTGCTTCCACCTCTGCCTATGG - Intronic
916501487 1:165391180-165391202 TATACTCCCACCAGTGCATAAGG - Intergenic
917253253 1:173086208-173086230 TCTCCTGCCAACAGTGCACAAGG - Intergenic
917654733 1:177114897-177114919 TCTTCATCCTCCAGTGCATATGG + Intronic
919266965 1:195281878-195281900 TCTCCCACCAACAGTGTGTAAGG - Intergenic
923010664 1:230085157-230085179 TCTCCTTTCACCACTGCGGATGG + Intronic
923706057 1:236345844-236345866 TCTGCTTCCATCTGTGAGTATGG + Intergenic
1067063755 10:43091879-43091901 TTACCTTCCAGCAGTGCGCAAGG - Intronic
1068882365 10:62064067-62064089 TCTCCTGCCACCAGTGAGACAGG + Intronic
1070087084 10:73247824-73247846 TCTCTCTCCACCAATGTGTAAGG - Exonic
1071758163 10:88569419-88569441 TCTCCTTCATCCAGTGTGTCTGG - Intronic
1073775637 10:106782750-106782772 TCTGCTTCCACCATTGTGAATGG + Intronic
1073790187 10:106932162-106932184 TATGCTTCTACCAGTGTGTATGG - Intronic
1075224204 10:120611301-120611323 TCTCCTTCCACCTGTTCTTGGGG + Intergenic
1077518734 11:3018467-3018489 TGTCCTTCCACGAGTGCATGAGG + Exonic
1078312052 11:10254021-10254043 ACTCCTTCCAACAGTGTGTAAGG - Intronic
1081000910 11:37669652-37669674 TCTCCTTTCACCAATGCCAAGGG + Intergenic
1081592734 11:44436144-44436166 CCTCCTTCCACCACTGTGTCTGG - Intergenic
1092764788 12:11842718-11842740 ACATTTTCCACCAGTGCGTAGGG + Intronic
1092770771 12:11894535-11894557 TCTCCTTTCACCAGTATGTTTGG + Exonic
1093708964 12:22307525-22307547 ACTCCTTGCACCTGTGGGTAGGG + Intronic
1094525636 12:31229068-31229090 CCTCCATCCACCAGTGAGCACGG - Intergenic
1105828422 13:24143125-24143147 TCTCCATCCACCACTGGGTGAGG + Intronic
1111476061 13:88749444-88749466 TTTCCTTTCACCAGTGTGTCAGG + Intergenic
1111619844 13:90710417-90710439 TATCCTTCCCCCAGTGAGTTAGG - Intergenic
1112150146 13:96750391-96750413 TCTCCTTCACCCAGTGAGGAAGG - Intronic
1113527706 13:110993884-110993906 TTCCCTTCCACCTGTGCGGAGGG + Intergenic
1116264877 14:42675065-42675087 TCTCCTGCCACCTGTGTGGAAGG - Intergenic
1119123281 14:72099516-72099538 ACTCCCTCCACCTGTGCCTAAGG - Intronic
1124027328 15:25978678-25978700 TCTCCCTCCATCAGTGCCTTTGG - Intergenic
1124689752 15:31812059-31812081 GCTGCTTCCACCAGTGCAGAAGG - Intronic
1125288301 15:38118387-38118409 TGTCCTTCCACCTCTGCCTATGG - Intergenic
1131094676 15:89647834-89647856 TTTCCTCCCACCAGTGGGTCTGG - Intronic
1141519368 16:84567475-84567497 TCTCCTTCCACCTCCACGTATGG - Intronic
1147484925 17:40803700-40803722 TCTCCTTCCACCAGGGGGCAGGG + Intergenic
1148092812 17:45032800-45032822 TCTCCTTCCACGAGGGTATAGGG - Intronic
1150054082 17:61995222-61995244 TCTCCTTCAACAAATGCATATGG + Exonic
1155017184 18:21855655-21855677 TCTCCATCCAGCAGTGTGCATGG + Intronic
1162727079 19:12696169-12696191 GCACCTTCCACCACTGGGTAGGG + Exonic
1168561932 19:57391652-57391674 TCTCCTTACACCAGTCAGAATGG - Intronic
925784753 2:7421170-7421192 TGTCTTTCCACCAGTGCCTGTGG + Intergenic
933098320 2:78216700-78216722 ACTCCTACCATCAGTGTGTAAGG - Intergenic
947183607 2:227434307-227434329 TCTCCTTTCACCAGGTTGTAGGG - Intergenic
1169794287 20:9444875-9444897 CCTCCATGCACCAGTGTGTATGG - Intronic
1170067551 20:12330472-12330494 GCTCCTTCCACCAGGAGGTAGGG + Intergenic
1170780567 20:19422040-19422062 TCTCTTTCCCCCAGTGCTTGAGG + Intronic
1171327056 20:24303988-24304010 CCTCCTTCCTCCGGTCCGTAAGG + Intergenic
1173423027 20:42919318-42919340 TCTCCTTACTCCATTGAGTATGG + Intronic
1174235700 20:49089629-49089651 TCTCCTTCAGCCAGTGCTTTGGG + Exonic
1178597548 21:33968362-33968384 TCTCCTTCCAGCAGTGGAAAGGG + Intergenic
951465467 3:22996603-22996625 TCTCCTTCCAGCAGTCCAAAAGG - Intergenic
954906440 3:54067242-54067264 TCGGCTTCCCCCAGTGCCTAAGG - Intergenic
966469504 3:180273183-180273205 TCTCCTTCCACCATTGTCTTGGG + Intergenic
966855146 3:184188747-184188769 TCTCCTCCCTCCAGGGCGGAGGG + Exonic
974027250 4:56744417-56744439 GCTTCTTCCACCATTGCTTAGGG - Intergenic
976236307 4:82900870-82900892 TCTCCTTCCACCAGTGCGTATGG + Exonic
981298518 4:143160499-143160521 TCTCTTTCTAACAGTGCTTAGGG - Intergenic
981588345 4:146328384-146328406 ACTCCAGCCACCAGTGCCTATGG + Intronic
982691810 4:158556452-158556474 TTTCCTACCAGCAGTGTGTAAGG - Intronic
985246750 4:187986709-187986731 TCTCCTTCCCCCAGCCCGTAGGG - Intergenic
999579472 5:153020247-153020269 ATTCCTCCCAACAGTGCGTAGGG - Intergenic
1016473583 6:144401733-144401755 TCTCCTTCCACAAGGGGGTAAGG + Intronic
1016984830 6:149887319-149887341 TCACCTTCCACCAGGGATTAAGG + Intronic
1018772784 6:166986581-166986603 ATTCCTTCCCCCAGTGTGTATGG + Intergenic
1026336688 7:69399767-69399789 TCTCCCCCCACCAGTGTGTCAGG + Intergenic
1031185402 7:118473473-118473495 TCTCCTTCCAAAAGTGCCTCCGG + Intergenic
1031531948 7:122886502-122886524 TTTCCTACCACCAGGGCGAAAGG + Intronic
1035933184 8:3807082-3807104 TAACCTTCCCCCAGTGCGTGGGG - Intronic
1041143710 8:54848511-54848533 TCTCTGTCCAGCAGTGTGTATGG - Intergenic
1041715143 8:60925456-60925478 TCCACTTCCACCAGTGCCTGGGG + Intergenic
1048643011 8:136385585-136385607 TCTTTTTCCACCAGTGCTTCTGG - Intergenic
1049455485 8:142684312-142684334 CCCCCTTCCACCAGGGGGTAGGG - Intergenic
1060059264 9:120444462-120444484 TCTCCTACCCCCAGTGCATGAGG + Intronic
1060810402 9:126608788-126608810 TCTCCTTCAACCAGGGCTTGAGG - Intergenic
1061684200 9:132261144-132261166 TGTCCCTCCACCAGTGCTTCTGG + Intergenic
1062371178 9:136239624-136239646 GCTCCATCCACCAGTCCGCAGGG + Intronic
1186315997 X:8371172-8371194 TCTACCTCTACCAGTGCTTAAGG + Intergenic
1192118265 X:68432071-68432093 TCTCCTTCCCCCATTGTGTGTGG - Intronic
1192213873 X:69144479-69144501 TGTCCTTCCACTTGTGCCTAGGG + Intergenic
1192893191 X:75412077-75412099 TCACCTTCCACCAGTTAGGATGG + Intronic
1199716493 X:150510683-150510705 TCTCATCCCACTGGTGCGTAAGG - Intronic
1200292823 X:154887951-154887973 TCTCCTTCCACTCGTCCGCACGG + Exonic
1200339669 X:155383691-155383713 TCTCCTTCCACTCGTCCGCACGG + Intergenic
1200346801 X:155457002-155457024 TCTCCTTCCACTCGTCCGCACGG - Exonic