ID: 976237328

View in Genome Browser
Species Human (GRCh38)
Location 4:82912233-82912255
Sequence TGATATATTTAGTGTGATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976237325_976237328 24 Left 976237325 4:82912186-82912208 CCTTTGAAATTAAGTCTTAATAT 0: 1
1: 0
2: 5
3: 35
4: 503
Right 976237328 4:82912233-82912255 TGATATATTTAGTGTGATCTTGG No data
976237327_976237328 -9 Left 976237327 4:82912219-82912241 CCTTGTTATAATAGTGATATATT 0: 1
1: 0
2: 5
3: 31
4: 352
Right 976237328 4:82912233-82912255 TGATATATTTAGTGTGATCTTGG No data
976237326_976237328 1 Left 976237326 4:82912209-82912231 CCTTAACTTTCCTTGTTATAATA 0: 1
1: 0
2: 2
3: 26
4: 329
Right 976237328 4:82912233-82912255 TGATATATTTAGTGTGATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976237328 Original CRISPR TGATATATTTAGTGTGATCT TGG Intronic
No off target data available for this crispr