ID: 976245479

View in Genome Browser
Species Human (GRCh38)
Location 4:83002317-83002339
Sequence CTTGAACTCCACCTGGGCTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 162}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976245479_976245489 30 Left 976245479 4:83002317-83002339 CCTAAGCCCAGGTGGAGTTCAAG 0: 1
1: 0
2: 2
3: 17
4: 162
Right 976245489 4:83002370-83002392 AAAAAAAGCAAGGGTGAGGGAGG 0: 1
1: 0
2: 12
3: 161
4: 1822
976245479_976245484 20 Left 976245479 4:83002317-83002339 CCTAAGCCCAGGTGGAGTTCAAG 0: 1
1: 0
2: 2
3: 17
4: 162
Right 976245484 4:83002360-83002382 TCACCTCTAAAAAAAAAGCAAGG 0: 1
1: 1
2: 5
3: 48
4: 615
976245479_976245487 26 Left 976245479 4:83002317-83002339 CCTAAGCCCAGGTGGAGTTCAAG 0: 1
1: 0
2: 2
3: 17
4: 162
Right 976245487 4:83002366-83002388 CTAAAAAAAAAGCAAGGGTGAGG 0: 1
1: 2
2: 7
3: 88
4: 1221
976245479_976245488 27 Left 976245479 4:83002317-83002339 CCTAAGCCCAGGTGGAGTTCAAG 0: 1
1: 0
2: 2
3: 17
4: 162
Right 976245488 4:83002367-83002389 TAAAAAAAAAGCAAGGGTGAGGG 0: 1
1: 1
2: 8
3: 162
4: 1797
976245479_976245485 21 Left 976245479 4:83002317-83002339 CCTAAGCCCAGGTGGAGTTCAAG 0: 1
1: 0
2: 2
3: 17
4: 162
Right 976245485 4:83002361-83002383 CACCTCTAAAAAAAAAGCAAGGG 0: 1
1: 1
2: 1
3: 132
4: 1857

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976245479 Original CRISPR CTTGAACTCCACCTGGGCTT AGG (reversed) Intronic
900710031 1:4107831-4107853 CTTCCCCTCCTCCTGGGCTTAGG + Intergenic
900801192 1:4738146-4738168 CTTGAAGGACGCCTGGGCTTTGG - Intronic
902651121 1:17838288-17838310 CTTAAATTCCACCCTGGCTTTGG - Intergenic
903010338 1:20325442-20325464 ATTGAGGTCTACCTGGGCTTGGG - Intronic
903327493 1:22577746-22577768 CATGCACACCACCTGGGCCTAGG - Intronic
904340883 1:29833766-29833788 CATAAACTCCAGCTGGGTTTAGG + Intergenic
904442480 1:30540717-30540739 CTTCAGCTGCACCTGGGCCTGGG - Intergenic
906038328 1:42766891-42766913 CTCGGACTCGACCTCGGCTTGGG + Exonic
906504060 1:46364458-46364480 CTTGAACTCCTCCTGACCTCAGG - Intronic
908386627 1:63648658-63648680 CTTGTACCCCAGCTGGGCTGTGG - Intronic
910420243 1:87053143-87053165 ATTCAACTCCAGCTGGGTTTGGG - Intronic
910961990 1:92772684-92772706 CTTGAACTCCTCCTGTCCTCAGG - Intronic
911207086 1:95102683-95102705 CTTGAAATCCATCTTAGCTTTGG - Intergenic
912205217 1:107501009-107501031 CATCCACTCCAACTGGGCTTGGG - Intergenic
912951798 1:114125371-114125393 CATGAAGTCCACTTGGCCTTGGG - Intronic
914260944 1:145998686-145998708 CTTGAACTCCTCCTGACCTCAGG + Intergenic
915210614 1:154306199-154306221 CTTGAAATGCTCCTGGGCTCCGG - Intergenic
917167430 1:172128045-172128067 CTTGAAATTCACCTTGGCTTTGG + Intronic
917435121 1:175013197-175013219 CTTCACCTCCACCTGAGTTTCGG + Exonic
917648270 1:177049803-177049825 CTTGGACTCCACCTTGGGTTCGG - Intronic
922360863 1:224819991-224820013 CTTGTGCTCCACCTTGGGTTAGG - Intergenic
922569320 1:226624543-226624565 TTAGAACAGCACCTGGGCTTGGG - Intergenic
924602148 1:245500675-245500697 CTTGAACTTCACCAGGGCGAGGG + Intronic
1064577674 10:16762623-16762645 TTTGAAGTTCACTTGGGCTTAGG - Intronic
1067066106 10:43105162-43105184 CTTGAACTCCACCACGGCGCTGG - Exonic
1073114715 10:101085267-101085289 CTTGAACTCCACCTGGGAGGTGG + Intergenic
1074692592 10:116019705-116019727 CTCCAACTCCAACTGGGATTTGG - Intergenic
1076364274 10:129911794-129911816 TTGGGAGTCCACCTGGGCTTGGG - Intronic
1076424505 10:130358060-130358082 CTTGAAAGCCACCTTGGCTTTGG - Intergenic
1078427625 11:11264785-11264807 CTGGAGCTCCACCTTGGCTAGGG - Intergenic
1078781335 11:14441935-14441957 CCTGGACTCCACCAGGTCTTTGG - Intergenic
1080414620 11:32057812-32057834 CTTGTAGTCCACTTGGGATTTGG + Intronic
1081700503 11:45149552-45149574 CTGGAGCTCTACCTGCGCTTGGG + Intronic
1083155339 11:60819438-60819460 CTTGACCTTCACCTGGTCATGGG - Intergenic
1084440036 11:69167558-69167580 CTTGGAGTCCAGCTGGTCTTCGG - Intergenic
1085510134 11:77084004-77084026 CTCAAACTCCATCTGGGCTGCGG - Intronic
1088814086 11:113409899-113409921 CTGGAACTCTATCTGGGCCTGGG - Exonic
1089104089 11:115987611-115987633 CTTGAACTCCACCTGTTTATTGG - Intergenic
1091203262 11:133799029-133799051 GTTGAACTACACCTGGAGTTGGG + Intergenic
1095089046 12:38087183-38087205 TTTGAACACCACCTGGGCTGGGG + Intergenic
1096262090 12:50099315-50099337 CTTGAAGACCACCTGGCCTGAGG - Exonic
1099357303 12:81653611-81653633 CTTGAAATCAACCTGGATTTAGG - Intronic
1100614500 12:96220606-96220628 CTTGAACTCCTCCTGACCTCAGG + Intronic
1100985537 12:100199334-100199356 CCTCCCCTCCACCTGGGCTTAGG - Intronic
1101299675 12:103466208-103466230 CTTTAACTCCATCTGGTCCTGGG + Intronic
1101878278 12:108609633-108609655 CTTGAGCCCCAGCTGGGCTGTGG - Intergenic
1102468508 12:113144900-113144922 CTCGAACTCCTCCTGACCTTAGG + Intergenic
1104064795 12:125297712-125297734 CTAGACCTCCACCTGTGATTTGG + Intronic
1104766448 12:131333301-131333323 CTTGATCTCCACCCTGGCCTTGG - Intergenic
1104812966 12:131629324-131629346 CTTGATCTCCACCCTGGCCTTGG + Intergenic
1106533439 13:30617363-30617385 CTTCAGCTCCACCGAGGCTTTGG + Intronic
1108752290 13:53460504-53460526 CTTGAATTCCAGCTGACCTTTGG + Intergenic
1112292826 13:98160112-98160134 CTTTCACTGGACCTGGGCTTTGG - Intronic
1116816146 14:49585496-49585518 CTCGAACTCCTCCTGGTCTCAGG - Intronic
1117546933 14:56801064-56801086 CTTGAACTCCACCTCTGCAGGGG - Exonic
1118761523 14:68883026-68883048 CTTGAACTGCTCATGGGCTGTGG + Exonic
1119928858 14:78524780-78524802 CTTGAACTCCACCTGGACCTAGG + Intronic
1121835832 14:97091440-97091462 TTGGAACTCTACCTGGCCTTGGG + Intergenic
1128349199 15:66877829-66877851 CTTTCCTTCCACCTGGGCTTGGG - Intergenic
1128386584 15:67153545-67153567 CTTGAGATCCCCCTGGGCTAAGG - Intronic
1129168502 15:73793423-73793445 CTTGAGGGTCACCTGGGCTTAGG - Intergenic
1131152305 15:90054624-90054646 CTTGAACTTCATCAGGGCCTGGG - Intronic
1132484926 16:185891-185913 CATGAACACAACGTGGGCTTGGG + Intergenic
1132825607 16:1903875-1903897 CTGCATCTCCACCTGGGCTGGGG - Intergenic
1133468013 16:6046666-6046688 CTTGAAATCCATCTTGGCTTTGG + Intronic
1133803289 16:9102347-9102369 CATATACTCCACCTGGGTTTTGG - Intronic
1137946009 16:52733894-52733916 CTTGAATTTCTTCTGGGCTTTGG - Intergenic
1138555642 16:57769830-57769852 CTTCATCTCCACCTGGGCTCTGG + Exonic
1138563479 16:57815982-57816004 CTTGAACTTCACCTGGGGTGAGG + Intronic
1139311632 16:66032778-66032800 CATGAACTCCTTCTGGGCTGAGG - Intergenic
1140644871 16:77018542-77018564 CTTGAACTCCAACTGGGACTGGG + Intergenic
1143260806 17:5596931-5596953 CTTTAACTCCACCAAGGGTTGGG - Intronic
1144057697 17:11557348-11557370 CCTGAACTCCGCCTGGTCCTGGG - Intronic
1144626636 17:16847298-16847320 CTTGAACCCGCCCTGGGCTGAGG + Intergenic
1144879796 17:18425413-18425435 CTTGAACCCACCCTGGGCTGAGG - Intergenic
1145017180 17:19406804-19406826 TTTCAACTCAACCTGGGCTGTGG - Intergenic
1145152438 17:20518971-20518993 CTTGAACCCACCCTGGGCTGAGG + Intergenic
1147580777 17:41625988-41626010 CTTGAACCCGCCCTGGGCTGAGG + Intergenic
1147612608 17:41810885-41810907 CTTGAAGTCCACCTGCTCATGGG + Exonic
1148260979 17:46183361-46183383 CTCAAACTCCTCCTGGGCTCAGG - Intronic
1149076388 17:52600171-52600193 ATTTAGCTCCAACTGGGCTTGGG - Intergenic
1149529298 17:57381925-57381947 CTTGAGCACCACCAGTGCTTTGG + Intronic
1150830911 17:68518465-68518487 CTTGTAAGCCACCAGGGCTTGGG + Intronic
1156847852 18:41689863-41689885 ATTGAACTCCAGCTTGGCTAGGG - Intergenic
1158428859 18:57365428-57365450 CTTGCTCTCCACCTTGTCTTTGG - Exonic
1160805293 19:989924-989946 CTGGAACTGCACCCGGGCTCAGG + Intronic
1161574612 19:5048692-5048714 CTTGGGCTCCATCTGCGCTTCGG - Intronic
1164709222 19:30343517-30343539 CTTCATCTCCACCTGGGCACAGG - Intronic
1167483825 19:49748519-49748541 CTGGAATTCTTCCTGGGCTTGGG - Intronic
1168224425 19:54984068-54984090 CTTGAACTCCGCCTGACCTCAGG + Intronic
925648636 2:6064904-6064926 CTTAAAATACACATGGGCTTAGG + Intergenic
927846550 2:26475280-26475302 CCTGCACTCCACCTGCGCTGAGG - Intronic
928105866 2:28470248-28470270 GTGTAACTCCACCTGGCCTTTGG + Intronic
928367502 2:30713968-30713990 CCTGCTCTCCACCTGGGCCTAGG + Intergenic
929519600 2:42635983-42636005 CTTGAACTATACCTGAGCTCAGG + Intronic
929601539 2:43207648-43207670 TCTGAAATCCACCTGAGCTTGGG + Intergenic
929674256 2:43909268-43909290 CCTGAAGTCAATCTGGGCTTTGG - Intronic
930337994 2:50074720-50074742 CTTCAACTCTTCCTGGGCTATGG - Intronic
934893119 2:98087692-98087714 GATGAAGTCCACCTGGGCTTTGG + Intronic
937095651 2:119233768-119233790 CCTGGCCTCCACCTGGGCCTAGG - Intronic
938084512 2:128389968-128389990 CATAAACTCCAGCAGGGCTTGGG - Intergenic
938923838 2:136020584-136020606 CTTGAACTCCTACTGGGCACTGG + Intergenic
941929215 2:170924185-170924207 CATGAACTCCACCTGGAACTGGG + Intergenic
942386154 2:175445322-175445344 ATTAATCTCCAACTGGGCTTTGG - Intergenic
944488035 2:200227259-200227281 CTTGAACTCCCTCTGGGATGTGG + Intergenic
945355832 2:208838458-208838480 ATTGGACTCACCCTGGGCTTGGG - Intronic
947233220 2:227910385-227910407 CTTGAACTCCTCCTGGGCTCAGG - Intronic
947595586 2:231409690-231409712 CTGGGCCTCCACCTGGGCCTGGG - Intergenic
947941563 2:234060565-234060587 CTGGATCATCACCTGGGCTTGGG + Intronic
948682995 2:239648963-239648985 CTGGAACTCCACCTGTGCTGGGG + Intergenic
948946381 2:241222395-241222417 CTGGAACTCCCACTGGGCTGTGG + Intronic
1169823125 20:9735804-9735826 CTTGAACTACTCCTGACCTTAGG - Intronic
1170391880 20:15884157-15884179 CTTTAAATACACATGGGCTTAGG - Intronic
1171406591 20:24915919-24915941 CTTGAACTCCAGGTGGGAGTCGG - Intergenic
1174216454 20:48920277-48920299 AGTGAACTGGACCTGGGCTTTGG - Intergenic
1176334643 21:5584609-5584631 CTTGAACTCAGCCTGTTCTTAGG - Intergenic
1176393114 21:6236339-6236361 CTTGAACTCAGCCTGTTCTTAGG + Intergenic
1176468305 21:7079835-7079857 CTTGAACTCAGCCTGTTCTTAGG - Intronic
1176491866 21:7461613-7461635 CTTGAACTCAGCCTGTTCTTAGG - Intergenic
1176508776 21:7676770-7676792 CTTGAACTCAGCCTGTTCTTAGG + Intergenic
1177167783 21:17622282-17622304 TTTGAGCTCCTCCTGGGCTGGGG - Intergenic
1178316903 21:31574439-31574461 CTTGACCTCCTCCTGGGTTTAGG - Intergenic
1179639327 21:42736818-42736840 CCTGAACTCCACCTGGCTTTGGG + Intronic
1179829239 21:43985859-43985881 CTTGCACTGCACCTAGGCTCAGG + Exonic
1181026020 22:20128198-20128220 CGTGCCCTCCACCTGGGCCTGGG + Intergenic
1181797939 22:25323597-25323619 CTTGAACTCCTCCTGACCTCAGG + Intergenic
1182282434 22:29225236-29225258 CTTGAGGTCCCCCTGGGCTGAGG + Intronic
1184091022 22:42293081-42293103 CTTGGCCTCCTCCTGGGCTTGGG - Intronic
1184172090 22:42765766-42765788 CCTGAGCTCCACCTGGGGTGTGG - Intergenic
950995477 3:17491906-17491928 CTGGAAATCCACCTGGTCCTGGG + Intronic
952327776 3:32336368-32336390 CTTGACCTCAAACTGGGCTGTGG + Intronic
954152403 3:48664002-48664024 CCTGACCTCTTCCTGGGCTTCGG - Intergenic
954809962 3:53241619-53241641 CCTGAAATCCACCTGTGCTCAGG - Intronic
957301538 3:78398001-78398023 CAAGCCCTCCACCTGGGCTTTGG - Intergenic
962517775 3:136169667-136169689 CTTGAACTCCTCCTGACCTCAGG + Intronic
967539439 3:190648422-190648444 CTTGAGCTCCAGGAGGGCTTGGG - Intronic
968844757 4:3034491-3034513 CGTGACCTAGACCTGGGCTTGGG - Intronic
969992096 4:11275204-11275226 CCTGAACTCCACCTAACCTTTGG + Intergenic
971062404 4:22987290-22987312 CCTGAACTACACATGGACTTTGG - Intergenic
976245479 4:83002317-83002339 CTTGAACTCCACCTGGGCTTAGG - Intronic
976425436 4:84897598-84897620 CTTGAACTCCTCCTGACCTCAGG + Intronic
979949531 4:126874749-126874771 CTTGAGCTCCAGGTGGGCATGGG - Intergenic
984768758 4:183419684-183419706 CTTCACCTCCACCTGGACCTCGG + Intergenic
992904971 5:81337105-81337127 CTTCAACTCCCCCTGTGCTGGGG - Intronic
993731581 5:91429152-91429174 GTTGAACTCCAGCTGGGCACAGG + Intergenic
998523223 5:142818963-142818985 CTTCAACTCCACCTGGACATTGG + Intronic
1000121588 5:158203138-158203160 CCTGCTCTCCAGCTGGGCTTTGG + Intergenic
1001268761 5:170295099-170295121 CTGGGACCCCACCTGGGATTAGG + Intronic
1003646362 6:7915822-7915844 CCTGACCTCCAGCTGGGGTTAGG + Intronic
1003718790 6:8677095-8677117 CTTGAACTCCTCCTGACCTCAGG + Intergenic
1004038191 6:11945144-11945166 CTCAAACTCCCCCTGGGCTCAGG - Intergenic
1006463419 6:34177171-34177193 CTTGAACTCCACCTGATGTCTGG + Intergenic
1015966912 6:138703284-138703306 CTTGACCTCCTCCTGGGCTCAGG - Intergenic
1016305369 6:142678566-142678588 CTGAAACTCCTCTTGGGCTTGGG - Intergenic
1017159752 6:151353673-151353695 CTGTAACTCCTCCTGTGCTTGGG - Exonic
1020026895 7:4905672-4905694 CTTGACCTCTGCCTGGGCCTGGG - Intergenic
1022064073 7:26832786-26832808 CTTGGTATCCTCCTGGGCTTAGG - Intronic
1022156498 7:27665998-27666020 CTTGAAATCTTCCTGGGTTTTGG - Intergenic
1032236677 7:130130392-130130414 CTTGATCTCCACATGGTATTGGG + Intronic
1033125157 7:138700879-138700901 CTTGAACTCCATCTGAGTTCAGG - Intronic
1036396032 8:8372001-8372023 CCTCAATTCCACCTGGGCTCAGG + Intronic
1038794089 8:30694531-30694553 CTTGAACTCCACCTGCTACTTGG + Intronic
1040486298 8:47874971-47874993 CTTGACCTCCTCCTGGGTTCAGG - Intronic
1040729295 8:50422951-50422973 CCTGAATTACATCTGGGCTTAGG - Intronic
1042878285 8:73460085-73460107 CTTGAATTGCATCTGAGCTTGGG - Intronic
1045768976 8:105711755-105711777 CTAAAACTCCATCTGGTCTTCGG - Intronic
1055683187 9:78740499-78740521 ATTAAACTCTAACTGGGCTTTGG + Intergenic
1056317274 9:85401952-85401974 CTTGAACTCCAACTAGGCATTGG + Intergenic
1059069134 9:111117073-111117095 CTTGAACTCCTCCTGACCTCAGG - Intergenic
1059923805 9:119186441-119186463 ATAGAACACCACCAGGGCTTAGG - Intronic
1203426992 Un_GL000195v1:50311-50333 CTTGAACTCAGCCTGTTCTTAGG + Intergenic
1188091375 X:25968890-25968912 CTTTTACTCAAACTGGGCTTTGG - Intergenic
1189273015 X:39764932-39764954 CTTGAACTCCACTCTGGCTGCGG - Intergenic
1191977599 X:66890868-66890890 CTTGAACTCCTCCTGACCTCAGG + Intergenic
1198217209 X:134566504-134566526 CATGAACTACACTTGGGCCTGGG - Exonic
1198644738 X:138793705-138793727 AGTGAAGTCCACATGGGCTTTGG + Intronic
1200158217 X:153989544-153989566 CTTGACCTCCACTGGGGCCTGGG + Intergenic
1200387609 X:155908742-155908764 CTTTGAAGCCACCTGGGCTTGGG + Intronic
1202046277 Y:20739645-20739667 CTTGAACTCCACAAGAGCTGAGG + Intergenic
1202115266 Y:21465670-21465692 CTTGAGGTCCCCCTGGGCCTCGG - Intergenic
1202338668 Y:23836866-23836888 CTGGAACTCCACCTGAGGTCAGG + Intergenic
1202532098 Y:25833206-25833228 CTGGAACTCCACCTGAGGTCAGG - Intergenic