ID: 976246570

View in Genome Browser
Species Human (GRCh38)
Location 4:83011238-83011260
Sequence TCCTGTCAAAGTAGTTCTGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 102}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976246570_976246574 29 Left 976246570 4:83011238-83011260 CCCGCAGAACTACTTTGACAGGA 0: 1
1: 0
2: 0
3: 10
4: 102
Right 976246574 4:83011290-83011312 TTGACACCTTTGTCAATTACAGG 0: 1
1: 0
2: 0
3: 16
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976246570 Original CRISPR TCCTGTCAAAGTAGTTCTGC GGG (reversed) Intronic