ID: 976246767

View in Genome Browser
Species Human (GRCh38)
Location 4:83012708-83012730
Sequence CCCGCTGCGAGTGCCTGCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 109}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976246767_976246777 10 Left 976246767 4:83012708-83012730 CCCGCGCAGGCACTCGCAGCGGG 0: 1
1: 0
2: 0
3: 8
4: 109
Right 976246777 4:83012741-83012763 CCCTTCCCGCCAGCCCGCCCAGG 0: 1
1: 0
2: 2
3: 41
4: 479
976246767_976246785 25 Left 976246767 4:83012708-83012730 CCCGCGCAGGCACTCGCAGCGGG 0: 1
1: 0
2: 0
3: 8
4: 109
Right 976246785 4:83012756-83012778 CGCCCAGGAGCCCCCATCCCGGG 0: 1
1: 0
2: 7
3: 29
4: 370
976246767_976246788 27 Left 976246767 4:83012708-83012730 CCCGCGCAGGCACTCGCAGCGGG 0: 1
1: 0
2: 0
3: 8
4: 109
Right 976246788 4:83012758-83012780 CCCAGGAGCCCCCATCCCGGGGG No data
976246767_976246784 24 Left 976246767 4:83012708-83012730 CCCGCGCAGGCACTCGCAGCGGG 0: 1
1: 0
2: 0
3: 8
4: 109
Right 976246784 4:83012755-83012777 CCGCCCAGGAGCCCCCATCCCGG 0: 1
1: 0
2: 3
3: 39
4: 318
976246767_976246786 26 Left 976246767 4:83012708-83012730 CCCGCGCAGGCACTCGCAGCGGG 0: 1
1: 0
2: 0
3: 8
4: 109
Right 976246786 4:83012757-83012779 GCCCAGGAGCCCCCATCCCGGGG 0: 1
1: 1
2: 1
3: 42
4: 313

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976246767 Original CRISPR CCCGCTGCGAGTGCCTGCGC GGG (reversed) Intronic
901631589 1:10650850-10650872 CCCGCTGCAACTGCCTGGGCGGG + Intronic
902545522 1:17187200-17187222 CCTGCTGCGAATGCTTGGGCAGG + Intergenic
903667092 1:25014654-25014676 GCTGCTGCGTGTGCCTGGGCAGG - Intergenic
907044842 1:51294390-51294412 CTCGCTGCCAGTGCCTGCTCTGG - Exonic
912385414 1:109268931-109268953 CCCGCTACGAGGCCCTGCGTGGG + Exonic
914001719 1:143699944-143699966 CCCGCTGCGGGAGCCGGCGGAGG + Intergenic
914514565 1:148362851-148362873 CCCGCTGCGGGAGCCGGCGGAGG + Intergenic
920038883 1:203083475-203083497 CCCGATGCCAGTGGCTGGGCTGG - Exonic
922722376 1:227905545-227905567 CCCACAGCGAGGGCCTGGGCAGG - Intergenic
1077018407 11:406978-407000 CCCGCAGGGAGGGCCTGTGCCGG - Exonic
1083666414 11:64277275-64277297 CAGGCTGCGAGTGTCTGCCCAGG - Intronic
1083922084 11:65786649-65786671 CCCGCGGAGCGTGCCAGCGCCGG + Intergenic
1091119891 11:133048041-133048063 CCCGATGAGAGTGTCTGGGCAGG - Intronic
1091213854 11:133887466-133887488 GCTGCTGCTAGTGCCTGCGTGGG - Intergenic
1091888111 12:4031358-4031380 GGCGCTGCGATTGGCTGCGCGGG + Intergenic
1101813670 12:108129474-108129496 CCCGGGGCGGGTGCCCGCGCGGG + Intronic
1103845834 12:123901467-123901489 CACGCTGCAAGTGCCAGTGCTGG + Intronic
1104891065 12:132140406-132140428 CCAGCTGTGAGTTCCTGGGCAGG - Exonic
1104961573 12:132490594-132490616 CCCGCTGCGCGCGCGAGCGCCGG - Exonic
1105559456 13:21476951-21476973 CCTGGTGCCAGTGCCTGGGCGGG + Intergenic
1106720081 13:32427779-32427801 CCCGCCGCGGGTGCCTGCCGCGG - Intronic
1114031266 14:18583152-18583174 CCCCCTGCCAGCGCCGGCGCAGG + Intergenic
1114558803 14:23577184-23577206 ACCGCGGCGAGTGGCTGGGCGGG - Exonic
1117157106 14:52951492-52951514 CCCGCGGCGTGTGTCCGCGCTGG + Intronic
1117920543 14:60722788-60722810 CCCGCAGAGACTGCCGGCGCCGG - Intronic
1126343945 15:47673656-47673678 CCTGCTGCAAGTTCCTGAGCAGG - Intronic
1127414906 15:58749094-58749116 CTCGCTGCGGCTGCCTGCACCGG + Intronic
1129319845 15:74768361-74768383 CCTGCTGCGAGTGGCTGCCCGGG + Intergenic
1132699916 16:1217934-1217956 ACCCCTGCGAGGGCCTGAGCAGG + Exonic
1132809718 16:1791724-1791746 CCCGCAGCGCGTTCCTGCTCAGG + Exonic
1132932124 16:2464184-2464206 CAAGCTGCGAGTGGCTGTGCTGG + Exonic
1136665491 16:31808219-31808241 CCTGCTGCTTGTGCCTGTGCAGG + Intergenic
1143140314 17:4738907-4738929 CTCGTTGCCATTGCCTGCGCGGG + Exonic
1149994651 17:61400173-61400195 CCCGATGAGAGAGCCGGCGCTGG + Exonic
1151559132 17:74861448-74861470 CCCGCGACGAGAGCCCGCGCCGG + Intronic
1151766508 17:76135953-76135975 CCTACTGCGAGGGCCTGCCCGGG - Intergenic
1151913430 17:77100047-77100069 CCCGCTGGGAGCGCCAGAGCAGG - Intronic
1152269801 17:79317530-79317552 GCTGCTGCCAGTGCCTGCTCAGG - Intronic
1160653415 19:246536-246558 CGCGCCGCGCCTGCCTGCGCCGG - Intergenic
1160984568 19:1832401-1832423 CCCGCTGCCTGTACCTGCGAAGG + Intronic
1162066975 19:8131741-8131763 TCCGCTGCCAGTGCCTGGGGGGG - Exonic
1164611137 19:29632460-29632482 CCCTCTGGGAGTCCCTGCTCCGG + Intergenic
1166765936 19:45252033-45252055 CCTGCTGAGAGTGCCAGGGCCGG - Intronic
1167307971 19:48719837-48719859 CCCGCTGGGAGGGCCTGTGCGGG + Intergenic
1167985937 19:53315753-53315775 CCCGCTGCTTGTGCCTGTGCAGG - Intergenic
1167998151 19:53423406-53423428 CCCGCCGCTTGTGCCTGTGCAGG - Intronic
1168007628 19:53504000-53504022 CCCGCCGCTTGTGCCTGTGCAGG - Intergenic
1168298119 19:55387802-55387824 CCCGTGGCGGGTGCCTGGGCAGG - Intronic
925314290 2:2909333-2909355 CCTGCTGTGATTGCCTGTGCTGG - Intergenic
931150483 2:59567514-59567536 GCCGGTGCGAGTGCCTGCATCGG - Intergenic
932327561 2:70873105-70873127 CCACCTGAGAGTGCCTGCCCAGG + Intergenic
932567319 2:72918016-72918038 CCCGCCGCCAGTGCCCCCGCCGG - Exonic
933587074 2:84190892-84190914 TCTGCTGGGAGTGCCTGGGCTGG - Intergenic
936525722 2:113240321-113240343 CCAGCTGCGAGTGCTGGCACGGG + Intronic
948587268 2:239027274-239027296 CCGGCTGGGAGTGCCGGCCCAGG - Intergenic
948918370 2:241049886-241049908 ACACCTGCGAGTGCCCGCGCGGG + Exonic
949026912 2:241770621-241770643 CCCGCTGGTAGTGCCTGCAGAGG + Intergenic
1169046242 20:2536578-2536600 CACGCTGCGTGAGCCTGTGCAGG + Intergenic
1172008860 20:31834697-31834719 CCCTCTGTGTGTGCCTGCACTGG + Intergenic
1172068758 20:32240620-32240642 CCTTCTGCCAGTGCCTGCCCAGG - Intergenic
1173249555 20:41357442-41357464 CCAACTGTGAGTGCCTGGGCTGG + Exonic
1173548159 20:43914841-43914863 CCCGCGGGCAGTGCCTGGGCGGG - Intergenic
1173741638 20:45406319-45406341 CCCGCGGCGGGCGCCCGCGCCGG - Intronic
1173840478 20:46153502-46153524 CCCGCTGCGCGAGCCTGGGCTGG - Intergenic
1175946998 20:62563605-62563627 CCCTCTGGGAGTGACTGAGCTGG - Intronic
1176408760 21:6436438-6436460 GCTGCTGTGAGTGCCTGCCCCGG + Intergenic
1176911457 21:14570106-14570128 CCCTTTGCGGGTGACTGCGCAGG + Intronic
1178544048 21:33479030-33479052 CCCGCTGCGCGTGCCTGGGTCGG - Intronic
1178962010 21:37073676-37073698 CCCGCTGCCCGTGCCTCGGCCGG + Intronic
1179684253 21:43044758-43044780 GCTGCTGTGAGTGCCTGCCCCGG + Intergenic
1179890185 21:44331302-44331324 CCCGCTGCTGGTGCCTGTGGTGG - Intronic
1180230913 21:46426404-46426426 CCTGCCCCGAGAGCCTGCGCTGG - Intronic
1180455379 22:15510210-15510232 CCCCCTGCCAGCGCCGGCGCAGG + Intergenic
1181681326 22:24497664-24497686 CCTGCTGCCACTGCCTGCCCTGG - Intronic
1181787264 22:25236193-25236215 GCCGCTGACAGTGCCTGGGCAGG + Intergenic
1182189222 22:28442264-28442286 GCCCGTGCGATTGCCTGCGCTGG - Intronic
1183549623 22:38474241-38474263 CCCCCTGCGTGTGCCTGCCTGGG - Intronic
1183986932 22:41575224-41575246 TGAGCTGCGAGAGCCTGCGCTGG + Exonic
1184731349 22:46372721-46372743 CACACTGCGAGTGCATGCACAGG - Intronic
964622594 3:158732232-158732254 CCTGCTGCAGGAGCCTGCGCGGG + Exonic
965051465 3:163655106-163655128 CCCGCTTCTGGTGCCTGCTCTGG - Intergenic
965534742 3:169812627-169812649 CCCGCTGGCTGTGCCTGCCCGGG + Exonic
966600275 3:181768161-181768183 CCACCTGCGACTTCCTGCGCGGG - Intergenic
975444379 4:74445354-74445376 CCCGCTGCTACCGCCGGCGCCGG + Exonic
976246767 4:83012708-83012730 CCCGCTGCGAGTGCCTGCGCGGG - Intronic
979530579 4:121765297-121765319 CCAGCTGGGAGAGTCTGCGCCGG - Intronic
981128608 4:141133375-141133397 CCCGCGGCAAGTGCGTGCCCAGG - Intronic
986321205 5:6633714-6633736 CAGGCTCCGAGTGCCGGCGCGGG + Exonic
987816065 5:22902053-22902075 CCGGCTCCCAGTGCCTGCTCAGG - Intergenic
992487692 5:77211273-77211295 CCCACGGCGTGTGCCAGCGCGGG - Intronic
1006362297 6:33593318-33593340 TCAGATGCGAGCGCCTGCGCAGG - Intergenic
1006547551 6:34792291-34792313 CCCGGTGAGAGCGCCAGCGCCGG + Exonic
1013693022 6:112667763-112667785 CCTGCTGTCAGTGCCTGCTCTGG + Intergenic
1018727821 6:166627240-166627262 TCCCCTGCGAGTACCAGCGCCGG + Intronic
1018810372 6:167294267-167294289 ACCCCTGTGAGTGCTTGCGCCGG - Intronic
1019983904 7:4641651-4641673 CCTGCTGCGTGTCCTTGCGCAGG - Intergenic
1023123689 7:36934450-36934472 CCTGCTGAGAGTGCCTTCCCAGG + Intronic
1025019388 7:55468649-55468671 CCCTCTGGAAGTGCCTGGGCGGG + Intronic
1025224900 7:57149683-57149705 CCAGCTGTGAATGCCTGCACTGG + Intergenic
1029658060 7:101940380-101940402 CCCGCTGGGGGTGCCTGTGATGG + Intronic
1031265226 7:119572583-119572605 CCTGCTCCTAGTGCCTGCTCTGG + Intergenic
1031989978 7:128191240-128191262 CCAGCTGTGAGGGCCTGTGCTGG - Intergenic
1032020635 7:128405649-128405671 CCCGGTGCGAGTGCCTGCTGTGG - Intronic
1034994719 7:155570629-155570651 CCTGCTGCTGGGGCCTGCGCTGG - Intergenic
1035659340 8:1334965-1334987 CCTGCTGGAAGTGCCTGCGAGGG - Intergenic
1036168074 8:6456581-6456603 CCCTCTGCCAGTGTCTGCCCAGG + Intronic
1037652426 8:20851001-20851023 CCAGCTGCAAGTGCCTGCCAAGG - Intergenic
1043666783 8:82825254-82825276 CCCACTGCTGGTGCCTGCTCTGG + Intergenic
1047400105 8:124539116-124539138 CCTGCTGCGGGTGACTGAGCGGG - Exonic
1047435792 8:124834668-124834690 CCCACTGCGAGGGCCTGCCATGG - Intergenic
1049592564 8:143469209-143469231 CCCTCTGCCAGGGCCTGGGCTGG + Intronic
1057665194 9:97039205-97039227 CGCGCTGCGATTGGCTGTGCCGG + Intronic
1060477409 9:123996974-123996996 TCCGCTGCGCCTGCCTCCGCAGG + Intergenic
1192216341 X:69161962-69161984 CCCGGTGCTAGTGCCAGTGCCGG - Exonic
1195726657 X:107924568-107924590 ACTGCTGTGAGTGCCTGCTCAGG - Intronic
1198705815 X:139447034-139447056 CAGGCTCCGAGTGCCGGCGCGGG + Intergenic
1200250381 X:154550608-154550630 CCCAGTGAGAGTGCCTGGGCAGG + Intronic
1200258617 X:154599644-154599666 CGCCCTGAGAGTGCCTGCTCAGG - Intergenic