ID: 976260305

View in Genome Browser
Species Human (GRCh38)
Location 4:83139122-83139144
Sequence CTGTGGCTTTGTAAGGGAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976260305_976260309 -10 Left 976260305 4:83139122-83139144 CCTCTTCCCTTACAAAGCCACAG No data
Right 976260309 4:83139135-83139157 AAAGCCACAGCCCACAGAGAGGG No data
976260305_976260317 17 Left 976260305 4:83139122-83139144 CCTCTTCCCTTACAAAGCCACAG No data
Right 976260317 4:83139162-83139184 GCAGCAGAATGACAGGGTTTAGG No data
976260305_976260311 -5 Left 976260305 4:83139122-83139144 CCTCTTCCCTTACAAAGCCACAG No data
Right 976260311 4:83139140-83139162 CACAGCCCACAGAGAGGGCCTGG No data
976260305_976260318 18 Left 976260305 4:83139122-83139144 CCTCTTCCCTTACAAAGCCACAG No data
Right 976260318 4:83139163-83139185 CAGCAGAATGACAGGGTTTAGGG No data
976260305_976260319 19 Left 976260305 4:83139122-83139144 CCTCTTCCCTTACAAAGCCACAG No data
Right 976260319 4:83139164-83139186 AGCAGAATGACAGGGTTTAGGGG 0: 1
1: 0
2: 1
3: 18
4: 202
976260305_976260314 10 Left 976260305 4:83139122-83139144 CCTCTTCCCTTACAAAGCCACAG No data
Right 976260314 4:83139155-83139177 GGGCCTGGCAGCAGAATGACAGG 0: 1
1: 0
2: 2
3: 22
4: 209
976260305_976260315 11 Left 976260305 4:83139122-83139144 CCTCTTCCCTTACAAAGCCACAG No data
Right 976260315 4:83139156-83139178 GGCCTGGCAGCAGAATGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976260305 Original CRISPR CTGTGGCTTTGTAAGGGAAG AGG (reversed) Intergenic
No off target data available for this crispr