ID: 976262344

View in Genome Browser
Species Human (GRCh38)
Location 4:83157798-83157820
Sequence CTCAGTGCACGCCAGTGCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976262342_976262344 -5 Left 976262342 4:83157780-83157802 CCCAGGCTGGAGTGCAATCTCAG 0: 44
1: 129
2: 1276
3: 33313
4: 148824
Right 976262344 4:83157798-83157820 CTCAGTGCACGCCAGTGCAGTGG No data
976262343_976262344 -6 Left 976262343 4:83157781-83157803 CCAGGCTGGAGTGCAATCTCAGT No data
Right 976262344 4:83157798-83157820 CTCAGTGCACGCCAGTGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976262344 Original CRISPR CTCAGTGCACGCCAGTGCAG TGG Intergenic
No off target data available for this crispr