ID: 976263802

View in Genome Browser
Species Human (GRCh38)
Location 4:83171473-83171495
Sequence CTGAGTAAAAAGAAAGATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976263802_976263805 -4 Left 976263802 4:83171473-83171495 CCACCATCTTTCTTTTTACTCAG No data
Right 976263805 4:83171492-83171514 TCAGTGGTTGCTAAAGAAACTGG No data
976263802_976263806 -3 Left 976263802 4:83171473-83171495 CCACCATCTTTCTTTTTACTCAG No data
Right 976263806 4:83171493-83171515 CAGTGGTTGCTAAAGAAACTGGG No data
976263802_976263807 4 Left 976263802 4:83171473-83171495 CCACCATCTTTCTTTTTACTCAG No data
Right 976263807 4:83171500-83171522 TGCTAAAGAAACTGGGAAGCAGG No data
976263802_976263808 12 Left 976263802 4:83171473-83171495 CCACCATCTTTCTTTTTACTCAG No data
Right 976263808 4:83171508-83171530 AAACTGGGAAGCAGGAACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976263802 Original CRISPR CTGAGTAAAAAGAAAGATGG TGG (reversed) Intergenic
No off target data available for this crispr