ID: 976264043

View in Genome Browser
Species Human (GRCh38)
Location 4:83173515-83173537
Sequence TGAGAATAAAACTTCCAGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976264043_976264048 17 Left 976264043 4:83173515-83173537 CCTAACTGGAAGTTTTATTCTCA No data
Right 976264048 4:83173555-83173577 ACTCCCTGGGGTCTTGCGCTGGG No data
976264043_976264046 5 Left 976264043 4:83173515-83173537 CCTAACTGGAAGTTTTATTCTCA No data
Right 976264046 4:83173543-83173565 TACTATTTATTGACTCCCTGGGG No data
976264043_976264047 16 Left 976264043 4:83173515-83173537 CCTAACTGGAAGTTTTATTCTCA No data
Right 976264047 4:83173554-83173576 GACTCCCTGGGGTCTTGCGCTGG No data
976264043_976264044 3 Left 976264043 4:83173515-83173537 CCTAACTGGAAGTTTTATTCTCA No data
Right 976264044 4:83173541-83173563 GTTACTATTTATTGACTCCCTGG No data
976264043_976264045 4 Left 976264043 4:83173515-83173537 CCTAACTGGAAGTTTTATTCTCA No data
Right 976264045 4:83173542-83173564 TTACTATTTATTGACTCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976264043 Original CRISPR TGAGAATAAAACTTCCAGTT AGG (reversed) Intergenic
No off target data available for this crispr