ID: 976264047

View in Genome Browser
Species Human (GRCh38)
Location 4:83173554-83173576
Sequence GACTCCCTGGGGTCTTGCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976264043_976264047 16 Left 976264043 4:83173515-83173537 CCTAACTGGAAGTTTTATTCTCA No data
Right 976264047 4:83173554-83173576 GACTCCCTGGGGTCTTGCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976264047 Original CRISPR GACTCCCTGGGGTCTTGCGC TGG Intergenic
No off target data available for this crispr