ID: 976264809

View in Genome Browser
Species Human (GRCh38)
Location 4:83180528-83180550
Sequence CAGGGTAAGGGGAAGTTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976264809_976264819 13 Left 976264809 4:83180528-83180550 CCCCCCAACTTCCCCTTACCCTG No data
Right 976264819 4:83180564-83180586 TGCCTTCCTAAACACTTATCTGG No data
976264809_976264820 14 Left 976264809 4:83180528-83180550 CCCCCCAACTTCCCCTTACCCTG No data
Right 976264820 4:83180565-83180587 GCCTTCCTAAACACTTATCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976264809 Original CRISPR CAGGGTAAGGGGAAGTTGGG GGG (reversed) Intergenic
No off target data available for this crispr