ID: 976264819

View in Genome Browser
Species Human (GRCh38)
Location 4:83180564-83180586
Sequence TGCCTTCCTAAACACTTATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976264818_976264819 -6 Left 976264818 4:83180547-83180569 CCTGAATACTCTGCAGCTGCCTT No data
Right 976264819 4:83180564-83180586 TGCCTTCCTAAACACTTATCTGG No data
976264807_976264819 22 Left 976264807 4:83180519-83180541 CCCAGGAATCCCCCCAACTTCCC No data
Right 976264819 4:83180564-83180586 TGCCTTCCTAAACACTTATCTGG No data
976264814_976264819 2 Left 976264814 4:83180539-83180561 CCCCTTACCCTGAATACTCTGCA No data
Right 976264819 4:83180564-83180586 TGCCTTCCTAAACACTTATCTGG No data
976264817_976264819 -5 Left 976264817 4:83180546-83180568 CCCTGAATACTCTGCAGCTGCCT No data
Right 976264819 4:83180564-83180586 TGCCTTCCTAAACACTTATCTGG No data
976264811_976264819 11 Left 976264811 4:83180530-83180552 CCCCAACTTCCCCTTACCCTGAA No data
Right 976264819 4:83180564-83180586 TGCCTTCCTAAACACTTATCTGG No data
976264809_976264819 13 Left 976264809 4:83180528-83180550 CCCCCCAACTTCCCCTTACCCTG No data
Right 976264819 4:83180564-83180586 TGCCTTCCTAAACACTTATCTGG No data
976264816_976264819 0 Left 976264816 4:83180541-83180563 CCTTACCCTGAATACTCTGCAGC 0: 12
1: 8
2: 2
3: 20
4: 154
Right 976264819 4:83180564-83180586 TGCCTTCCTAAACACTTATCTGG No data
976264808_976264819 21 Left 976264808 4:83180520-83180542 CCAGGAATCCCCCCAACTTCCCC No data
Right 976264819 4:83180564-83180586 TGCCTTCCTAAACACTTATCTGG No data
976264812_976264819 10 Left 976264812 4:83180531-83180553 CCCAACTTCCCCTTACCCTGAAT No data
Right 976264819 4:83180564-83180586 TGCCTTCCTAAACACTTATCTGG No data
976264813_976264819 9 Left 976264813 4:83180532-83180554 CCAACTTCCCCTTACCCTGAATA No data
Right 976264819 4:83180564-83180586 TGCCTTCCTAAACACTTATCTGG No data
976264815_976264819 1 Left 976264815 4:83180540-83180562 CCCTTACCCTGAATACTCTGCAG 0: 12
1: 5
2: 5
3: 16
4: 165
Right 976264819 4:83180564-83180586 TGCCTTCCTAAACACTTATCTGG No data
976264806_976264819 23 Left 976264806 4:83180518-83180540 CCCCAGGAATCCCCCCAACTTCC No data
Right 976264819 4:83180564-83180586 TGCCTTCCTAAACACTTATCTGG No data
976264810_976264819 12 Left 976264810 4:83180529-83180551 CCCCCAACTTCCCCTTACCCTGA No data
Right 976264819 4:83180564-83180586 TGCCTTCCTAAACACTTATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976264819 Original CRISPR TGCCTTCCTAAACACTTATC TGG Intergenic
No off target data available for this crispr