ID: 976267185

View in Genome Browser
Species Human (GRCh38)
Location 4:83195446-83195468
Sequence AAGAGCAAGGAGAAGAGGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976267185_976267190 -5 Left 976267185 4:83195446-83195468 CCCGCCCTCTTCTCCTTGCTCTT No data
Right 976267190 4:83195464-83195486 CTCTTGCCCGAACATGTGCCTGG No data
976267185_976267194 6 Left 976267185 4:83195446-83195468 CCCGCCCTCTTCTCCTTGCTCTT No data
Right 976267194 4:83195475-83195497 ACATGTGCCTGGCAACATGGCGG No data
976267185_976267193 3 Left 976267185 4:83195446-83195468 CCCGCCCTCTTCTCCTTGCTCTT No data
Right 976267193 4:83195472-83195494 CGAACATGTGCCTGGCAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976267185 Original CRISPR AAGAGCAAGGAGAAGAGGGC GGG (reversed) Intergenic
No off target data available for this crispr