ID: 976280486

View in Genome Browser
Species Human (GRCh38)
Location 4:83322082-83322104
Sequence TCCTCCACAGGTCAGATGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 206}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976280477_976280486 8 Left 976280477 4:83322051-83322073 CCTGCCCACTGCCTCCTCCTCTT 0: 1
1: 1
2: 10
3: 144
4: 1526
Right 976280486 4:83322082-83322104 TCCTCCACAGGTCAGATGAGGGG 0: 1
1: 0
2: 2
3: 15
4: 206
976280479_976280486 3 Left 976280479 4:83322056-83322078 CCACTGCCTCCTCCTCTTGTTCA 0: 1
1: 0
2: 14
3: 207
4: 2156
Right 976280486 4:83322082-83322104 TCCTCCACAGGTCAGATGAGGGG 0: 1
1: 0
2: 2
3: 15
4: 206
976280482_976280486 -9 Left 976280482 4:83322068-83322090 CCTCTTGTTCAGATTCCTCCACA 0: 1
1: 0
2: 2
3: 14
4: 177
Right 976280486 4:83322082-83322104 TCCTCCACAGGTCAGATGAGGGG 0: 1
1: 0
2: 2
3: 15
4: 206
976280481_976280486 -6 Left 976280481 4:83322065-83322087 CCTCCTCTTGTTCAGATTCCTCC 0: 1
1: 0
2: 0
3: 25
4: 347
Right 976280486 4:83322082-83322104 TCCTCCACAGGTCAGATGAGGGG 0: 1
1: 0
2: 2
3: 15
4: 206
976280478_976280486 4 Left 976280478 4:83322055-83322077 CCCACTGCCTCCTCCTCTTGTTC 0: 1
1: 0
2: 6
3: 88
4: 919
Right 976280486 4:83322082-83322104 TCCTCCACAGGTCAGATGAGGGG 0: 1
1: 0
2: 2
3: 15
4: 206
976280480_976280486 -3 Left 976280480 4:83322062-83322084 CCTCCTCCTCTTGTTCAGATTCC 0: 1
1: 0
2: 2
3: 43
4: 496
Right 976280486 4:83322082-83322104 TCCTCCACAGGTCAGATGAGGGG 0: 1
1: 0
2: 2
3: 15
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976280486 Original CRISPR TCCTCCACAGGTCAGATGAG GGG Intronic
900197488 1:1384094-1384116 TCCACCACAGGCCAGAAAAGAGG + Intergenic
902973055 1:20069237-20069259 TATTGCATAGGTCAGATGAGGGG - Intronic
904424021 1:30412106-30412128 TCCTCCACCGTCCAGGTGAGAGG - Intergenic
905608072 1:39322176-39322198 TTCCCCACAGGTGAGATGAAAGG + Intronic
908949933 1:69548166-69548188 TCCTCCTCCTGTCAGATCAGAGG + Intergenic
909058776 1:70854480-70854502 ATCTCCACATGTCAGAGGAGGGG + Intronic
909591459 1:77353737-77353759 CCCTCCAGAGGCCAGCTGAGTGG - Intronic
911166497 1:94729329-94729351 TCCTACCCATGTCAGAAGAGTGG + Intergenic
912299442 1:108499549-108499571 TACTCCATAGGGCTGATGAGAGG - Intergenic
914139890 1:144936581-144936603 TCCTCCCCAGGTTAGATGTAAGG - Intronic
915945765 1:160150724-160150746 TCCTCCACTTGTCAGCTGTGTGG - Intergenic
916611245 1:166393952-166393974 TCATCCTAAGGTCAGATGTGAGG - Intergenic
917536911 1:175881043-175881065 GCCTCCACAAGTGACATGAGTGG + Intergenic
917620748 1:176793307-176793329 TCCTGGACAGGACAGAGGAGGGG + Intronic
919851357 1:201675121-201675143 TCATCCCCAGGTCAGAGGTGGGG - Intronic
920485058 1:206362120-206362142 TCCTCCCCAGGTTAGATGTAAGG + Intronic
921988036 1:221333952-221333974 TCCTCCACACGCAAGATCAGAGG - Intergenic
923034937 1:230279159-230279181 TCCTCGGCCGTTCAGATGAGAGG + Intronic
924152103 1:241140073-241140095 GCCTCCAGAGCACAGATGAGGGG - Intronic
924165730 1:241280292-241280314 CCCTCCAGAGGCCAGAAGAGGGG + Intronic
1062921665 10:1284967-1284989 TCCTGCAGAGGACAGGTGAGTGG + Intronic
1063097607 10:2922106-2922128 TCACCCACAGGGCAGGTGAGGGG - Intergenic
1065645183 10:27826613-27826635 TCTTCCACATGACAGATGGGAGG - Intronic
1066217475 10:33301635-33301657 ACCACCACAGGGCATATGAGTGG - Intronic
1066707740 10:38200053-38200075 TCCTCCATAGGTCTGTTGTGGGG - Intergenic
1067374443 10:45714447-45714469 TCCTCCTCCTGTCAGATCAGTGG + Intergenic
1067379236 10:45757812-45757834 TCCTCCTCCTGTCAGATCAGTGG - Intronic
1067768766 10:49108815-49108837 TCCATCACAGGTCAGCTCAGGGG - Intronic
1067882256 10:50056089-50056111 TCCTCCTCCTGTCAGATCAGTGG + Intergenic
1067886938 10:50098475-50098497 TCCTCCTCCTGTCAGATCAGTGG - Intronic
1068526898 10:58140751-58140773 CTCTCCACATGTGAGATGAGAGG + Intergenic
1069154659 10:65012633-65012655 TCCACCTCCTGTCAGATGAGTGG + Intergenic
1070566195 10:77605481-77605503 TCCTGGAGAGGTCAGATGATGGG + Intronic
1073023670 10:100469752-100469774 TGTTCTACAGGTCAGATGTGTGG + Intronic
1074628474 10:115221126-115221148 TCCACCTCCTGTCAGATGAGTGG - Intronic
1076572481 10:131441598-131441620 CCCTCCACGGGACAGATGGGAGG + Intergenic
1077868544 11:6242396-6242418 TACTGCACAGGGCTGATGAGAGG - Intronic
1077980177 11:7292196-7292218 TGTTCCACAGGGTAGATGAGAGG + Intronic
1078520951 11:12062402-12062424 CCCTCTCCTGGTCAGATGAGAGG - Intergenic
1078527968 11:12114893-12114915 GCCTCCACAGGTCACACGTGGGG + Intronic
1080054023 11:27886645-27886667 TTTTCCACATGTCATATGAGAGG - Intergenic
1084686792 11:70700799-70700821 GCCTCCACAGGCTGGATGAGGGG + Intronic
1088880521 11:113970091-113970113 ACCTCAAAAGGTCAGATGAATGG - Intergenic
1089469444 11:118708967-118708989 TTCCCCACAGGTGAGATGTGTGG - Intergenic
1090189844 11:124760544-124760566 TCCTCCAGAGCCCAGAAGAGCGG + Intronic
1090481417 11:127071986-127072008 TGCTCCTCAGGTCCAATGAGGGG - Intergenic
1090983727 11:131747549-131747571 TCTTCCACATCTGAGATGAGTGG + Intronic
1094488095 12:30940846-30940868 TCCGCCACCTGTCAGATAAGTGG + Intronic
1094687996 12:32738426-32738448 TCTTCCACAGGTTAGATAAAAGG - Intronic
1097173396 12:57129377-57129399 TCCTTCACAATTCAGATGGGGGG - Intronic
1097323675 12:58252351-58252373 TCCTCAACAGGACAAGTGAGGGG - Intergenic
1098696709 12:73567539-73567561 TCCTCCTCCCGTCAGATCAGCGG + Intergenic
1099822647 12:87732776-87732798 TTATTTACAGGTCAGATGAGGGG + Intergenic
1100384767 12:94095615-94095637 TGCTCCAGTGGTCAGATGGGTGG - Intergenic
1100799405 12:98215608-98215630 ACCTTGACAGGTCAAATGAGAGG - Intergenic
1102435365 12:112918738-112918760 TCTCCCATTGGTCAGATGAGAGG - Intronic
1103629694 12:122249902-122249924 TCCTTCATATGTCAGCTGAGTGG + Exonic
1105234692 13:18537967-18537989 TACTCCACATGTCAGATGAATGG - Intergenic
1108320122 13:49281557-49281579 TCCACCTCCTGTCAGATGAGCGG - Intronic
1110543606 13:76732779-76732801 TCCTCCAGAAGACAGAAGAGGGG - Intergenic
1110722996 13:78786600-78786622 TCCTGCACAGGGCTGAGGAGGGG + Intergenic
1112156607 13:96824126-96824148 TCTTCAATAGGTAAGATGAGGGG - Intronic
1112445642 13:99462126-99462148 TCCTCCACTGACCAGAGGAGGGG + Intergenic
1112711894 13:102138676-102138698 TCCTGAACAGGACAGAGGAGAGG + Intronic
1113218789 13:108074214-108074236 ACCTCCAAGGGTAAGATGAGTGG + Intergenic
1118235723 14:64003649-64003671 TTCTCCTCAGGACAGATGACTGG + Intronic
1121374911 14:93399628-93399650 ACCTCCAAAGGTCAGATGAGAGG - Intronic
1123554300 15:21411499-21411521 TCCTCCTCCTGTCAGATCAGCGG - Intronic
1124239761 15:28019653-28019675 TCCTCCACAGGGCAGGCCAGAGG + Intronic
1124713987 15:32041468-32041490 TCCGCCTCCGGTCAGATCAGCGG - Intronic
1125536868 15:40446077-40446099 ACCTCCACAGGACAGAGGACAGG + Intronic
1129145406 15:73642458-73642480 TCCTACAGAGAGCAGATGAGTGG - Intergenic
1130443311 15:83976705-83976727 TCCGCCTCCTGTCAGATGAGTGG - Intronic
1131337139 15:91560040-91560062 TCTTCTACAGGTATGATGAGAGG + Intergenic
1202962647 15_KI270727v1_random:138697-138719 TCCTCCTCCTGTCAGATCAGCGG - Intergenic
1133102127 16:3485990-3486012 TCCTCAGCAGGTCAGCTGAATGG - Exonic
1135910537 16:26556671-26556693 TCTTCCCCAGGTGAGATTAGAGG + Intergenic
1136511121 16:30738825-30738847 TTCTCCACAGGTGACAGGAGGGG - Exonic
1136577307 16:31132298-31132320 CCCTCCACAGGGCAGGAGAGTGG + Exonic
1136926990 16:34383474-34383496 CCCTCCAAAGGTCAGGTGTGGGG + Intergenic
1136977584 16:35028333-35028355 CCCTCCAAAGGTCAGGTGTGGGG - Intergenic
1138774871 16:59709103-59709125 TCCACCTCATGTCAGATCAGCGG - Intergenic
1139511210 16:67429686-67429708 TCCTCCTAAGGACAGATGACAGG - Intergenic
1140382314 16:74500990-74501012 TCCTCCAGAGGACCGAGGAGAGG - Intronic
1140418652 16:74797476-74797498 TCCTCCTCCTGTCAGATCAGTGG - Intergenic
1141378832 16:83557088-83557110 TCCTCCTCCTGTCAGATGAGTGG + Intronic
1142405058 16:89883979-89884001 TGCTCCACAGCACAGAAGAGGGG + Intronic
1143659284 17:8314896-8314918 TTCTCCACAGGGAAGAGGAGGGG + Exonic
1143809783 17:9461973-9461995 TCCGCCTCCTGTCAGATGAGCGG - Intronic
1146689377 17:34862647-34862669 TCCGCCTCTTGTCAGATGAGCGG + Intergenic
1146873961 17:36393004-36393026 TCTGCCACCTGTCAGATGAGTGG - Intronic
1147049963 17:37786848-37786870 TCCTCCAAAGTGCAGCTGAGGGG - Intergenic
1147065427 17:37919869-37919891 TCTGCCACCTGTCAGATGAGTGG + Intergenic
1147561087 17:41509633-41509655 TTCCCCACAGGTGACATGAGGGG - Intergenic
1150230139 17:63545255-63545277 TCCTGCACAGGTAAGAGGTGAGG + Exonic
1151598773 17:75093821-75093843 TGCTCCACATGGCAGGTGAGCGG + Exonic
1152465719 17:80464974-80464996 TCCCCGACTGTTCAGATGAGGGG - Intergenic
1154455084 18:14514283-14514305 TCCTCCTCCTGTCAGATCAGCGG - Intronic
1154498166 18:14977684-14977706 ACCTGCACAGGTCAGATAAAGGG - Intergenic
1154514850 18:15151889-15151911 TACTCCACATGTCAGATGAATGG + Intergenic
1158896840 18:61922093-61922115 TCCGCCTCCTGTCAGATGAGCGG + Intergenic
1160192552 18:76726108-76726130 TCCGCCTCCTGTCAGATGAGTGG - Intergenic
1160568521 18:79801103-79801125 TCCCCGCCACGTCAGATGAGAGG + Intergenic
1160961050 19:1720993-1721015 GCCTGCACAGATCAGATGGGGGG - Intergenic
1161520255 19:4719910-4719932 CCCTCCTGAGGTCAGCTGAGCGG - Exonic
1163332007 19:16645363-16645385 TCCCTCACAGGCCAGATGAATGG - Exonic
1165660655 19:37577980-37578002 TCCGCCTCCGGTCAGATCAGCGG + Intronic
1166495458 19:43299896-43299918 TCCCCCACAAGAAAGATGAGGGG + Intergenic
1167963215 19:53123838-53123860 TCCTGCACATCTCAGATGAGCGG - Intronic
925737438 2:6976100-6976122 TCCTCCACTGGGCACATGACTGG + Intronic
926324441 2:11772138-11772160 TCCTCCTCCTGCCAGATGAGTGG - Intronic
927337972 2:21947427-21947449 TGCTCCACATGTCACATGTGAGG - Intergenic
928425610 2:31175323-31175345 TGCCCCACAGGTGAAATGAGTGG - Intronic
930483011 2:51972898-51972920 AACTCCACAGGTCAGGTGAGTGG + Intergenic
930935944 2:56951574-56951596 TCCTCCTCCTGTCAGATCAGTGG - Intergenic
932830440 2:74984773-74984795 TCCTCCACAGGTCTATTCAGCGG - Intergenic
933652604 2:84861486-84861508 TCCTCCTCCTGTCAGATCAGTGG - Intronic
937986983 2:127642392-127642414 TCCTGCACAGCCCAGAAGAGTGG + Intronic
938282814 2:130077697-130077719 TCCTCCTCCTGTCAGATCAGCGG - Intronic
938333448 2:130466268-130466290 TCCTCCTCCTGTCAGATCAGCGG - Intronic
938356365 2:130654403-130654425 TCCTCCTCCTGTCAGATCAGCGG + Intronic
938432799 2:131261208-131261230 TCCTCCTCCTGTCAGATCAGCGG + Intronic
938515106 2:131996656-131996678 TACTCCACATGTCAGATGAATGG + Intergenic
940060192 2:149557434-149557456 TCTTCCACAGCTCAGGAGAGAGG - Intergenic
941646378 2:168045950-168045972 CACTCCACAGGTCAAAGGAGTGG + Intronic
941769514 2:169329930-169329952 TCCGCCTCCTGTCAGATGAGTGG + Intronic
941778078 2:169414373-169414395 TCCTCCTCAGATCAGCTGAAGGG + Intergenic
943768370 2:191688068-191688090 TCCACCTCCTGTCAGATGAGTGG - Intronic
946779144 2:223175126-223175148 TTTTCCAGAGGTCAGATAAGAGG - Intronic
947063868 2:226197994-226198016 ATCCCCACATGTCAGATGAGGGG - Intergenic
1171130956 20:22652589-22652611 CCCTCCACATGTAAGAGGAGGGG - Intergenic
1172621994 20:36323855-36323877 TCCTCCTCCTGTCAGATCAGCGG - Intronic
1173475397 20:43355658-43355680 TGCTCCCCAGGTCAGCTGTGAGG - Intergenic
1174031892 20:47635476-47635498 AGCACCACAGGGCAGATGAGTGG + Exonic
1174088119 20:48024855-48024877 TCCTGCAAATGGCAGATGAGAGG + Intergenic
1175595149 20:60225137-60225159 ACCACCAGAGGGCAGATGAGAGG + Intergenic
1176778684 21:13166253-13166275 TACTCCACATGTCAGATGAATGG - Intergenic
1176819082 21:13638995-13639017 TCCTCCTCCTGTCAGATCAGCGG + Intronic
1179260762 21:39756624-39756646 TCCTCCACAGCACCAATGAGTGG - Intronic
1181768679 22:25110682-25110704 ACCTGCATGGGTCAGATGAGCGG + Intronic
1181775301 22:25154844-25154866 TGCTCTGCAGGGCAGATGAGAGG + Intronic
1182297718 22:29319333-29319355 TCCTCCACAGCTCACATGCTTGG + Intronic
1185054911 22:48574629-48574651 CCCTGCACAGGTCAGGAGAGAGG + Intronic
950446227 3:13040461-13040483 ACCTCCATAGGTCAGGGGAGGGG + Intronic
952491791 3:33880854-33880876 TCACCCACTGGTCAGATGTGAGG + Intergenic
952899833 3:38102855-38102877 TCCTCCTCATGACAGTTGAGAGG + Intronic
954005979 3:47590825-47590847 CCCTCCACAGGTCAGATACCAGG - Exonic
954580981 3:51702810-51702832 TCCTGGACAGGGCAGATGAAGGG + Intronic
957856089 3:85880780-85880802 TCCACCTCCTGTCAGATGAGTGG - Intronic
958858078 3:99410862-99410884 TCCTCCAGAGGTCAGATCATTGG - Intergenic
961096631 3:124162200-124162222 TGCTCCACAGGTTAGAAGACAGG + Intronic
961228762 3:125280698-125280720 TCTTCCACATGTCTGATGAAAGG - Intronic
961810893 3:129521172-129521194 TCCTTCACAGGGCTGCTGAGAGG - Intergenic
963845098 3:150147465-150147487 TCCTCCCCAGGCAAAATGAGGGG + Intergenic
965785533 3:172331034-172331056 TAATCCACAGGTGAGATGAGTGG - Intronic
967960109 3:194913624-194913646 TCCTCCCCAAGTCACATGAAAGG + Intergenic
968848704 4:3062998-3063020 TCCTCCCCAGGCCAGGGGAGGGG + Intergenic
969301228 4:6298693-6298715 TCTTCCACAGATGAGAGGAGAGG - Intronic
970696684 4:18686193-18686215 TCCTGCTCAGAACAGATGAGGGG + Intergenic
971673181 4:29591012-29591034 TCCTCCTCCTGTCAGATCAGTGG - Intergenic
972437325 4:39045862-39045884 TCTTCCAGAGGTTAGATGTGCGG + Intronic
975792471 4:77969066-77969088 TCCTGAAAAGGTCAGAAGAGAGG + Intergenic
976280486 4:83322082-83322104 TCCTCCACAGGTCAGATGAGGGG + Intronic
976511979 4:85921756-85921778 TCCTCCTCCTGTCAGATCAGTGG + Intronic
978974183 4:114848629-114848651 TCCTCCAGGAGTCAGGTGAGTGG + Intronic
979378599 4:119980336-119980358 TCTTCCACAGGTCAAATAATAGG - Intergenic
982113822 4:152080266-152080288 TCCTTCACAGAACAGCTGAGAGG + Intergenic
984902448 4:184597317-184597339 TCTTACACAGATCAAATGAGAGG - Intergenic
986480627 5:8183502-8183524 TCTTCCTCAGGTAATATGAGTGG + Intergenic
986627846 5:9739315-9739337 ACCTGCAGAGGGCAGATGAGGGG - Intergenic
990000675 5:50888090-50888112 TTTTCCACATGGCAGATGAGAGG - Intergenic
992300148 5:75369612-75369634 ACCTCCACAGGACTGTTGAGTGG + Intronic
993386407 5:87267962-87267984 TCCTCCACCAGGCAGATGAGAGG - Exonic
994829080 5:104754603-104754625 TTCTCCACAGGTCAGAGGGCTGG + Intergenic
997468932 5:134105809-134105831 ACCTCCCAAAGTCAGATGAGGGG - Intergenic
997605236 5:135170523-135170545 GGCTCCAGAGGTCAGATGAAAGG + Intronic
997859394 5:137402817-137402839 TCCTACACAGTGCAGATGAGAGG + Intronic
998063354 5:139136559-139136581 ACCTACACAGGTCAAAAGAGTGG + Intronic
999262224 5:150245189-150245211 TCCTCCACAGGAGGGAAGAGTGG - Exonic
999371633 5:151058875-151058897 TCCTCCAGAGTTCAGAGAAGTGG - Intronic
1000225873 5:159261589-159261611 TCCTCCACACATTAGAAGAGAGG + Intergenic
1001979656 5:176030317-176030339 TCCACCACAGGACTGATGGGAGG - Intronic
1002237761 5:177813446-177813468 TCCACCACAGGACTGATGGGAGG + Intergenic
1002960221 6:1907249-1907271 AGCTCCACATGACAGATGAGGGG + Intronic
1004160172 6:13205928-13205950 TCCTACACAGCCCAGAAGAGTGG + Exonic
1004459274 6:15820541-15820563 TTCTCCTCAGGTCAAAAGAGGGG - Intergenic
1004926286 6:20418196-20418218 CACTCCACAAGTCAGATGGGAGG - Intronic
1005921446 6:30405514-30405536 TCCGCCTCTGGTCAGATCAGTGG + Intergenic
1007679079 6:43621957-43621979 TTCTCCAGAGGTCAGAAAAGAGG - Intronic
1008115374 6:47543557-47543579 TCCTCTACAAGCCAGAAGAGGGG - Intronic
1009968461 6:70602292-70602314 TTTTCCACAGGTCAGAAGACTGG - Intergenic
1013426983 6:110021248-110021270 TCCTGCACAGGTGAGATGAGGGG - Intergenic
1013437722 6:110128820-110128842 TCCACCACCTGTCAGATCAGTGG + Intronic
1014206818 6:118665158-118665180 TCAGCCACAGGTAAGATGAGTGG + Intronic
1016266634 6:142239895-142239917 TCCTCCCTAGGTCTGAGGAGTGG - Intergenic
1016316992 6:142801120-142801142 TTCTCTGCAGGTCAGAAGAGAGG + Intronic
1017746987 6:157455950-157455972 TCCCCCACAAGTCAGATTAAAGG - Intronic
1021590386 7:22254870-22254892 TCCACCACCTGTCAGATCAGTGG - Intronic
1023491063 7:40742538-40742560 TCCGCCTCCTGTCAGATGAGCGG - Intronic
1024983390 7:55176113-55176135 TCCTACACAGCACAGGTGAGGGG - Intronic
1028798899 7:94938163-94938185 TCCTTCTCTTGTCAGATGAGTGG + Intronic
1029440583 7:100584836-100584858 TCCCCCACCGTGCAGATGAGAGG + Intronic
1034761999 7:153681318-153681340 TCCACCAGAGGTCTGTTGAGAGG + Intergenic
1040087472 8:43360521-43360543 TCCTCCTCCTGTCAGATCAGTGG + Intergenic
1040597088 8:48848893-48848915 TCCTTGACTGGTCAGATGTGGGG - Intergenic
1041779570 8:61562868-61562890 ACCTACTCAGGTCATATGAGAGG - Exonic
1041929910 8:63275664-63275686 TCCATCATAGGTCAGATGACAGG - Intergenic
1047942378 8:129837789-129837811 GCCACCACAGCTCAGAGGAGAGG + Intergenic
1048458288 8:134598227-134598249 TCCTCCACTGGGCAGATTAGGGG - Intronic
1050074221 9:1847021-1847043 TCCACCACCTGTCAGATCAGTGG - Intergenic
1050278358 9:4024058-4024080 TCCTCCACAGGTGGTTTGAGAGG + Intronic
1053007429 9:34613322-34613344 ACCTCCAAATGTCAGATGATGGG - Intergenic
1056283614 9:85066104-85066126 TGCTCAACAGGTCTGATGAAGGG - Intergenic
1057007153 9:91570308-91570330 TCCACCTCCTGTCAGATGAGTGG - Intronic
1058000113 9:99856377-99856399 TCCGCCTCCTGTCAGATGAGTGG - Intronic
1059361827 9:113749499-113749521 TCCACCACCTGTCAGATCAGTGG + Intergenic
1059924682 9:119196670-119196692 TCCTCCACAGGTTTATTGAGAGG - Intronic
1061961129 9:133989896-133989918 CCCTCCACGGGACAGAGGAGTGG + Intronic
1203528275 Un_GL000213v1:110505-110527 TCCTCCTCCTGTCAGATCAGCGG - Intergenic
1192684543 X:73289490-73289512 TTCACCACAGGGAAGATGAGGGG - Intergenic
1195322011 X:103728120-103728142 TCCTCCTCAGGTGAGCTGAGTGG - Exonic
1196685986 X:118510704-118510726 TCTTACACAGGACATATGAGAGG - Intronic
1198483382 X:137061822-137061844 TCCTTCACACATCTGATGAGAGG - Intergenic
1201415963 Y:13749898-13749920 TCTTCCTCAGGTCAGATCAGTGG - Intergenic