ID: 976282052

View in Genome Browser
Species Human (GRCh38)
Location 4:83335062-83335084
Sequence CCATCTCCGCACCCTTCAAG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 121}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976282052_976282064 10 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 976282052 4:83335062-83335084 CCACTTGAAGGGTGCGGAGATGG 0: 1
1: 0
2: 0
3: 3
4: 121
Right 976282064 4:83335095-83335117 AGCGCCCGGGAGGCCTGGGGAGG 0: 1
1: 0
2: 2
3: 43
4: 373
976282052_976282059 0 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 976282052 4:83335062-83335084 CCACTTGAAGGGTGCGGAGATGG 0: 1
1: 0
2: 0
3: 3
4: 121
Right 976282059 4:83335085-83335107 CCGGGATCCAAGCGCCCGGGAGG 0: 1
1: 0
2: 0
3: 4
4: 59
976282052_976282060 5 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 976282052 4:83335062-83335084 CCACTTGAAGGGTGCGGAGATGG 0: 1
1: 0
2: 0
3: 3
4: 121
Right 976282060 4:83335090-83335112 ATCCAAGCGCCCGGGAGGCCTGG 0: 1
1: 0
2: 0
3: 7
4: 102
976282052_976282063 7 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 976282052 4:83335062-83335084 CCACTTGAAGGGTGCGGAGATGG 0: 1
1: 0
2: 0
3: 3
4: 121
Right 976282063 4:83335092-83335114 CCAAGCGCCCGGGAGGCCTGGGG 0: 1
1: 0
2: 0
3: 11
4: 195
976282052_976282057 -3 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 976282052 4:83335062-83335084 CCACTTGAAGGGTGCGGAGATGG 0: 1
1: 0
2: 0
3: 3
4: 121
Right 976282057 4:83335082-83335104 TGGCCGGGATCCAAGCGCCCGGG 0: 1
1: 0
2: 0
3: 9
4: 90
976282052_976282067 19 Complete closest: 33
total_pairs: 2
max_distance: 1000
Left 976282052 4:83335062-83335084 CCACTTGAAGGGTGCGGAGATGG 0: 1
1: 0
2: 0
3: 3
4: 121
Right 976282067 4:83335104-83335126 GAGGCCTGGGGAGGAGCGCCCGG 0: 1
1: 0
2: 8
3: 76
4: 561
976282052_976282069 21 Complete closest: 35
total_pairs: 2
max_distance: 1000
Left 976282052 4:83335062-83335084 CCACTTGAAGGGTGCGGAGATGG 0: 1
1: 0
2: 0
3: 3
4: 121
Right 976282069 4:83335106-83335128 GGCCTGGGGAGGAGCGCCCGGGG 0: 1
1: 0
2: 2
3: 45
4: 625
976282052_976282056 -4 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 976282052 4:83335062-83335084 CCACTTGAAGGGTGCGGAGATGG 0: 1
1: 0
2: 0
3: 3
4: 121
Right 976282056 4:83335081-83335103 ATGGCCGGGATCCAAGCGCCCGG 0: 1
1: 0
2: 0
3: 4
4: 57
976282052_976282071 24 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 976282052 4:83335062-83335084 CCACTTGAAGGGTGCGGAGATGG 0: 1
1: 0
2: 0
3: 3
4: 121
Right 976282071 4:83335109-83335131 CTGGGGAGGAGCGCCCGGGGAGG 0: 1
1: 0
2: 5
3: 43
4: 429
976282052_976282068 20 Complete closest: 34
total_pairs: 2
max_distance: 1000
Left 976282052 4:83335062-83335084 CCACTTGAAGGGTGCGGAGATGG 0: 1
1: 0
2: 0
3: 3
4: 121
Right 976282068 4:83335105-83335127 AGGCCTGGGGAGGAGCGCCCGGG 0: 1
1: 0
2: 2
3: 63
4: 706
976282052_976282061 6 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 976282052 4:83335062-83335084 CCACTTGAAGGGTGCGGAGATGG 0: 1
1: 0
2: 0
3: 3
4: 121
Right 976282061 4:83335091-83335113 TCCAAGCGCCCGGGAGGCCTGGG 0: 1
1: 0
2: 0
3: 6
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976282052 Original CRISPR CCATCTCCGCACCCTTCAAG TGG (reversed) Exonic
902676382 1:18011398-18011420 CCATCCCCCCACCCTGCAACAGG - Intergenic
903052512 1:20612249-20612271 CTATCTCCTCACCCTTAAAGTGG + Intronic
908830326 1:68172154-68172176 CCATCCCCCCACCCCTCAACAGG - Intronic
909608867 1:77532561-77532583 CCATTTCCTCATCCTTAAAGTGG + Intronic
911733861 1:101316192-101316214 GCAAATCTGCACCCTTCAAGTGG - Intergenic
912076179 1:105878975-105878997 CCAGCTCCCCACCCCTCAACAGG + Intergenic
912665580 1:111576628-111576650 CCCTCCCCTCACCCTTCCAGAGG - Intronic
915191419 1:154154111-154154133 CCCTGTCCTCACACTTCAAGCGG + Intronic
916864653 1:168843326-168843348 CCACTTCAGGACCCTTCAAGAGG - Intergenic
918207796 1:182324837-182324859 ACATCTCCTCATCCTTCCAGAGG + Intergenic
920444581 1:206006214-206006236 CCATTTCTGCACCCTTGAAAGGG - Intergenic
921436176 1:215125581-215125603 CCATCTCCCCACCCCACAACAGG - Intronic
921493268 1:215805127-215805149 CCATCTCCCCACCCCACAACAGG - Intronic
922786422 1:228284717-228284739 CCATCACCGCAGCCTTCACTTGG + Intronic
924031840 1:239893519-239893541 CCATTTCTTCACCCTTAAAGTGG + Intronic
1063598636 10:7460401-7460423 CCATCTCCCCACCCCACAACAGG - Intergenic
1063673263 10:8116999-8117021 CCATCTCCGCAGCCGTTAAATGG + Intergenic
1065905571 10:30248223-30248245 CCATCTCCCCACCCTCCTATGGG - Intergenic
1069863842 10:71488076-71488098 CCAACTCTGTGCCCTTCAAGGGG + Intronic
1072896059 10:99367852-99367874 CCAGCCCCTCCCCCTTCAAGTGG - Intronic
1072902132 10:99417894-99417916 CCCTCTCCGCACCCCACAACAGG - Intronic
1073848123 10:107583136-107583158 CCACCTCAGCCCCCTGCAAGTGG + Intergenic
1074984606 10:118646476-118646498 CCATCCCCCCACCCTACAACAGG + Intergenic
1076272396 10:129165845-129165867 CCATCTCTGCAACCTGCATGTGG + Intergenic
1079333449 11:19551929-19551951 ACATCTCCTCTCCTTTCAAGAGG + Intronic
1079444506 11:20546737-20546759 CCACCTCCACCCACTTCAAGTGG - Intergenic
1080260275 11:30342382-30342404 CCATCCACCCACCCATCAAGAGG - Intergenic
1090432282 11:126656014-126656036 CCATTTCCACACACTTCTAGAGG - Intronic
1091562702 12:1627215-1627237 CCTGCTCAGCACCCTTGAAGAGG + Intronic
1094192432 12:27711014-27711036 CCACCGCGGCACCCTTCATGAGG - Intronic
1096150720 12:49310145-49310167 CCCTCCCCCCACCCTTCAACAGG + Intergenic
1097774901 12:63634056-63634078 CCTTCCCCGCACCCTACAATAGG - Intronic
1098119964 12:67226241-67226263 CCATCTCCCCACCCTCCAGCAGG + Intergenic
1098642084 12:72851507-72851529 CCATCTCCCCACCCCACAACAGG + Intergenic
1098688125 12:73451566-73451588 CCATCCCCCCACCCTACAACAGG + Intergenic
1100839078 12:98593861-98593883 CCGTCTCCACGCCCTTGAAGAGG - Intronic
1100901323 12:99243862-99243884 CCAGCTCCCCACCCCGCAAGAGG - Intronic
1103137761 12:118522423-118522445 CCATCTCCCCACCCGACAATAGG + Intergenic
1103981416 12:124739272-124739294 CCATTTCCGCACCCGTAAAATGG - Intergenic
1106139980 13:27003993-27004015 CCTTCTCCGCACCACCCAAGGGG + Intergenic
1106409134 13:29498940-29498962 CCATCTCCGCATCTGTAAAGCGG - Intronic
1108127148 13:47256851-47256873 CCATTTCCACACCCCTGAAGAGG + Intergenic
1110195368 13:72782173-72782195 CCATCTCCGCACCCGCAAGGAGG - Exonic
1114744642 14:25134503-25134525 CCTTCTCCTACCCCTTCAAGGGG - Intergenic
1117903686 14:60562290-60562312 CCATCTCCACTGCCTCCAAGTGG + Intergenic
1118030233 14:61812165-61812187 CCATCTCCGTAGGCTCCAAGTGG - Intergenic
1119427757 14:74546902-74546924 CCTGCTCCCCACCCTTCCAGTGG + Intronic
1133485697 16:6216122-6216144 CCAACTCCCCACCCTCCAAAAGG - Intronic
1134319553 16:13150285-13150307 ACATCTACTCACCTTTCAAGAGG + Intronic
1136395452 16:29990215-29990237 CCCTCTCCGCACATTTTAAGTGG - Intronic
1146987990 17:37240521-37240543 CCATCACCACAGCCTTCATGTGG + Exonic
1149431203 17:56596426-56596448 CCTCCTCCCCACCCCTCAAGGGG - Intergenic
1149645228 17:58235999-58236021 CCATCTGCACACCCCTCCAGAGG + Intronic
1152756301 17:82088475-82088497 TCATCTCCCCACTCATCAAGTGG - Exonic
1155903294 18:31418199-31418221 CCCACTCTGCACCCTCCAAGAGG - Intergenic
1157086693 18:44587424-44587446 CCATCTCCCCTCCTTTCAAAGGG + Intergenic
1158175767 18:54654344-54654366 CCTTCTCCTGACCCTCCAAGGGG + Intergenic
1159427318 18:68306337-68306359 CCATCCCCCCACCCTACAACAGG - Intergenic
1163976435 19:20857473-20857495 CCATCCCCCCACCCTACAACAGG - Intronic
1166742989 19:45125521-45125543 CCATCCCTGCACCCATCAGGAGG - Intronic
1167577126 19:50323135-50323157 CCATCACCCCACCCTCCATGGGG - Exonic
1167577836 19:50326279-50326301 TCATCTCAGCACCCTTCAATGGG + Intronic
1168489834 19:56799441-56799463 CCCACTCCGCACCCTGCAACAGG - Intronic
925468277 2:4131583-4131605 CAAGCTCAGCACACTTCAAGGGG - Intergenic
927558832 2:24054379-24054401 CCATCACCCCACCCCTCAAATGG - Intronic
936701738 2:115019007-115019029 CCATCACCGCACCCATCAGCAGG + Intronic
941073200 2:160977985-160978007 TCATCTCCGCAGCCTTCAGCTGG + Intergenic
944950771 2:204746129-204746151 CCCTCCCCCCACCCTACAAGAGG + Intronic
946724821 2:222652025-222652047 CCATTTCCGCCCCTTTGAAGTGG + Intronic
948386258 2:237582773-237582795 CCATCTCCTCATCCTAAAAGTGG + Intronic
1171029172 20:21661750-21661772 CCTGCTCCGCACCCTTCTTGGGG - Intergenic
1172007336 20:31826522-31826544 CCATACCCGCACCCTTGAACAGG - Intronic
1173691911 20:44967036-44967058 CCCCCACCGCACCCCTCAAGTGG - Intronic
1180187135 21:46145566-46145588 CCAGCGCCGCACCCTGCGAGAGG + Exonic
1183702974 22:39460192-39460214 CCATCTCCAAGCCCTTCATGTGG + Intronic
1185320273 22:50197492-50197514 CCATCCCCGTCACCTTCAAGAGG + Exonic
954622107 3:52002247-52002269 CCATCTCCCCACCTGTGAAGTGG - Intergenic
954752892 3:52823621-52823643 CCATCTCTGAGCCCTTGAAGAGG + Exonic
956525811 3:70159323-70159345 CCATCCCCCCACCCCACAAGAGG + Intergenic
958678575 3:97296445-97296467 CCACCTCAGCATTCTTCAAGGGG - Intronic
959682001 3:109106657-109106679 CCATCTCCTCACCCCTCACACGG + Intronic
967892673 3:194374109-194374131 CCATCTGCTCTCCCTTCAGGAGG + Intergenic
968073255 3:195801419-195801441 CCTTCTCCGCACCCTCCCCGGGG + Intronic
968218453 3:196914889-196914911 CTATCTCCGCACACTGCCAGGGG - Intronic
972984215 4:44744137-44744159 CCATCTCTCCACCCCACAAGAGG + Intergenic
973577095 4:52301295-52301317 CTATCTCCTCACCCTACAACAGG + Intergenic
974255992 4:59456302-59456324 CCCTCTCCCCACCCCTCAACAGG + Intergenic
976282052 4:83335062-83335084 CCATCTCCGCACCCTTCAAGTGG - Exonic
976375162 4:84338285-84338307 CCATTTCTGCATGCTTCAAGGGG + Intergenic
977081943 4:92541136-92541158 CCCTCTCCCCACCCTACAACAGG - Intronic
984739852 4:183150677-183150699 CCATCTCCCCACCCCACAACAGG + Intronic
990643158 5:57811029-57811051 CCCTCTCCCCACCCTACAACAGG - Intergenic
995472402 5:112516633-112516655 CCATCCCCCCACCCCACAAGAGG + Intergenic
996359267 5:122627647-122627669 CCCTCTCCACACTCTTCATGTGG + Intergenic
997516271 5:134492037-134492059 GCATCTCCGCACCTCACAAGTGG + Intergenic
999904562 5:156125511-156125533 CCATCTCAGCAGCTTTCTAGCGG - Intronic
1000662155 5:163950252-163950274 CCATCTCCCCAGCCTTCATCAGG - Intergenic
1001572170 5:172736993-172737015 CCACCTCCTCACCCTCCTAGGGG + Intergenic
1006600910 6:35225234-35225256 CCATCTCCTCCCCCTTAAAATGG - Intronic
1010531003 6:76967080-76967102 CCATCTCAGCTGCCTTTAAGGGG - Intergenic
1012067740 6:94570781-94570803 ACATCCCAGCACCCTTCAAGGGG + Intergenic
1018098564 6:160415687-160415709 CCTTCTCCGCACCCTATAATGGG - Intronic
1022755526 7:33284151-33284173 CCAACTCTGCAGACTTCAAGCGG - Intronic
1024231041 7:47363811-47363833 CCATCACCTAACCCTGCAAGGGG - Intronic
1033914644 7:146308820-146308842 CCGTCTCCCCACCCTACAACAGG - Intronic
1037638449 8:20721340-20721362 CCATCCCTGCATCCATCAAGTGG + Intergenic
1040751321 8:50712652-50712674 CCATATCCCCACCCCTCAACAGG + Intronic
1041206753 8:55507499-55507521 CCCTCCCCGCACCCTACAACAGG + Intronic
1043243890 8:77973903-77973925 CCAGCCCCCCACCCTTCAACAGG + Intergenic
1048714005 8:137246573-137246595 CCATCCCCTCACCCTACAACAGG - Intergenic
1050537859 9:6645713-6645735 CCTGCTCCGCACACTTTAAGCGG + Intergenic
1050780154 9:9323839-9323861 CCATCCCCGCACCCCACAACAGG + Intronic
1051840589 9:21393092-21393114 CCATCTCAGCACTCTGCACGTGG - Intergenic
1056182298 9:84097151-84097173 TCTTCTCCCCACCCTTAAAGTGG + Intergenic
1059046882 9:110878616-110878638 CCATCTCAGCACCTCTGAAGTGG + Intronic
1059416211 9:114163980-114164002 CCATCTCTTCACCCTTGATGGGG + Intronic
1059672175 9:116501999-116502021 CCTTCTCCCCACCCTTCTGGAGG - Intronic
1062190862 9:135247177-135247199 TCCTCTCCCCACCCTCCAAGGGG + Intergenic
1185481838 X:452021-452043 ACAGCTCCCCACCCTTCAGGAGG - Intergenic
1189546806 X:42050144-42050166 CCATCTCAGCAACGTTGAAGGGG - Intergenic
1193392254 X:80942531-80942553 CCATCCCCCCACCCTACAACAGG - Intergenic
1194587308 X:95751733-95751755 CCCACTCCACACCCTCCAAGAGG + Intergenic
1194652288 X:96530399-96530421 CCATCCCCCCACCCTACAACAGG - Intergenic
1199918756 X:152373775-152373797 CCATCCCCCCACCCTACAACAGG + Intronic
1201952482 Y:19580654-19580676 CCCTCTCCCCACCCTACAACAGG + Intergenic