ID: 976282940

View in Genome Browser
Species Human (GRCh38)
Location 4:83342968-83342990
Sequence CATTGTAACTATTAGGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976282935_976282940 6 Left 976282935 4:83342939-83342961 CCAAAAAGCACATGTTGAAATTT No data
Right 976282940 4:83342968-83342990 CATTGTAACTATTAGGAGGTGGG No data
976282934_976282940 9 Left 976282934 4:83342936-83342958 CCTCCAAAAAGCACATGTTGAAA No data
Right 976282940 4:83342968-83342990 CATTGTAACTATTAGGAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976282940 Original CRISPR CATTGTAACTATTAGGAGGT GGG Intergenic
No off target data available for this crispr