ID: 976284623

View in Genome Browser
Species Human (GRCh38)
Location 4:83359544-83359566
Sequence CTTTAGATAAGCAGTGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976284617_976284623 14 Left 976284617 4:83359507-83359529 CCCTTGCACTAACAATATATGTG No data
Right 976284623 4:83359544-83359566 CTTTAGATAAGCAGTGAGGAGGG No data
976284620_976284623 -9 Left 976284620 4:83359530-83359552 CCACAGTGGATCTGCTTTAGATA No data
Right 976284623 4:83359544-83359566 CTTTAGATAAGCAGTGAGGAGGG No data
976284618_976284623 13 Left 976284618 4:83359508-83359530 CCTTGCACTAACAATATATGTGC No data
Right 976284623 4:83359544-83359566 CTTTAGATAAGCAGTGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976284623 Original CRISPR CTTTAGATAAGCAGTGAGGA GGG Intergenic
No off target data available for this crispr