ID: 976285037

View in Genome Browser
Species Human (GRCh38)
Location 4:83363098-83363120
Sequence TCTCTGCGGTTGGGCTCCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976285029_976285037 22 Left 976285029 4:83363053-83363075 CCTGAACTAAGTCAATAAATTAA No data
Right 976285037 4:83363098-83363120 TCTCTGCGGTTGGGCTCCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976285037 Original CRISPR TCTCTGCGGTTGGGCTCCAT GGG Intergenic