ID: 976287826

View in Genome Browser
Species Human (GRCh38)
Location 4:83387058-83387080
Sequence GCCAGAACCACCACCATTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976287817_976287826 27 Left 976287817 4:83387008-83387030 CCCACAGGACTAGAAAGAACAAA No data
Right 976287826 4:83387058-83387080 GCCAGAACCACCACCATTGGTGG No data
976287818_976287826 26 Left 976287818 4:83387009-83387031 CCACAGGACTAGAAAGAACAAAA No data
Right 976287826 4:83387058-83387080 GCCAGAACCACCACCATTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976287826 Original CRISPR GCCAGAACCACCACCATTGG TGG Intergenic
No off target data available for this crispr