ID: 976291834

View in Genome Browser
Species Human (GRCh38)
Location 4:83426736-83426758
Sequence GTATTCTTTTAGAAGAGACG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976291830_976291834 -4 Left 976291830 4:83426717-83426739 CCATGACCAACTAATTTCTGTAT 0: 1
1: 38
2: 1712
3: 28105
4: 60688
Right 976291834 4:83426736-83426758 GTATTCTTTTAGAAGAGACGGGG No data
976291828_976291834 27 Left 976291828 4:83426686-83426708 CCTGAGTAGCTGGGACTACTGGT 0: 214
1: 29331
2: 149647
3: 248598
4: 217805
Right 976291834 4:83426736-83426758 GTATTCTTTTAGAAGAGACGGGG No data
976291829_976291834 -1 Left 976291829 4:83426714-83426736 CCACCATGACCAACTAATTTCTG 0: 1
1: 35
2: 1785
3: 29465
4: 79664
Right 976291834 4:83426736-83426758 GTATTCTTTTAGAAGAGACGGGG No data
976291831_976291834 -10 Left 976291831 4:83426723-83426745 CCAACTAATTTCTGTATTCTTTT 0: 1
1: 12
2: 405
3: 5594
4: 25509
Right 976291834 4:83426736-83426758 GTATTCTTTTAGAAGAGACGGGG No data
976291826_976291834 30 Left 976291826 4:83426683-83426705 CCTCCTGAGTAGCTGGGACTACT 0: 382
1: 42851
2: 162121
3: 222043
4: 208793
Right 976291834 4:83426736-83426758 GTATTCTTTTAGAAGAGACGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976291834 Original CRISPR GTATTCTTTTAGAAGAGACG GGG Intronic
No off target data available for this crispr