ID: 976306544

View in Genome Browser
Species Human (GRCh38)
Location 4:83565694-83565716
Sequence CCCGGTGGGTACCCCGAGTC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 2, 2: 17, 3: 18, 4: 64}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976306533_976306544 17 Left 976306533 4:83565654-83565676 CCAGGCTAATTTTTGTGTTGGGG 0: 1
1: 4
2: 57
3: 1182
4: 16339
Right 976306544 4:83565694-83565716 CCCGGTGGGTACCCCGAGTCCGG 0: 1
1: 2
2: 17
3: 18
4: 64
976306537_976306544 -9 Left 976306537 4:83565680-83565702 CCAGCCCCACACCACCCGGTGGG 0: 3
1: 14
2: 34
3: 47
4: 288
Right 976306544 4:83565694-83565716 CCCGGTGGGTACCCCGAGTCCGG 0: 1
1: 2
2: 17
3: 18
4: 64
976306529_976306544 29 Left 976306529 4:83565642-83565664 CCTGCCATCATGCCAGGCTAATT 0: 49
1: 1662
2: 21399
3: 63489
4: 85301
Right 976306544 4:83565694-83565716 CCCGGTGGGTACCCCGAGTCCGG 0: 1
1: 2
2: 17
3: 18
4: 64
976306530_976306544 25 Left 976306530 4:83565646-83565668 CCATCATGCCAGGCTAATTTTTG 0: 110
1: 3863
2: 40568
3: 119482
4: 199091
Right 976306544 4:83565694-83565716 CCCGGTGGGTACCCCGAGTCCGG 0: 1
1: 2
2: 17
3: 18
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976306544 Original CRISPR CCCGGTGGGTACCCCGAGTC CGG Intronic
902956991 1:19932184-19932206 CCCGTAGGGTACCCAAAGTCCGG + Intergenic
904242421 1:29156755-29156777 CCCGTAGGGTACCCAAAGTCTGG + Intronic
906124092 1:43415975-43415997 CCCAGTAGGTCCCCTGAGTCTGG - Exonic
916218507 1:162419894-162419916 CCCAGAGGGTACCCGGAGTCCGG - Intergenic
921065961 1:211621997-211622019 CCCAGTGGGGTCCCCGGGTCTGG + Intergenic
923081857 1:230665226-230665248 CCAGCTGGGTAGCCTGAGTCAGG + Intronic
924775104 1:247111133-247111155 CCCGGCGGGTACCCCGAGTCCGG - Exonic
924792583 1:247266459-247266481 CCCAGTGGGCACCCCAATTCCGG - Intergenic
1064782368 10:18856671-18856693 CCCAGCAGGTACCCCGAGTCCGG + Intergenic
1067945513 10:50685969-50685991 CCCTGTGGGTTCCCAGAGCCTGG - Intergenic
1070867026 10:79712842-79712864 CCCTGTGGGTTCCCAGAGCCTGG - Intronic
1070880816 10:79850963-79850985 CCCTGTGGGTTCCCAGAGCCTGG - Intergenic
1071633938 10:87235065-87235087 CCCTGTGGGTTCCCAGAGCCTGG - Intronic
1077386596 11:2272141-2272163 GCAGGTGGGCACCCCGAGGCTGG - Intergenic
1082570079 11:54727840-54727862 CCCCGTGGGTACTCCGTGTGTGG + Intergenic
1084916728 11:72434262-72434284 CCCGGTGGCTGCCCCACGTCCGG + Exonic
1086003080 11:82003172-82003194 CCGTGTGGGGCCCCCGAGTCTGG + Intergenic
1088810204 11:113387147-113387169 CCCCGTGGCCACCCCGAGGCTGG + Intergenic
1091963613 12:4720033-4720055 CCCAGCGGATACCCCGAGTCCGG + Intronic
1092871560 12:12810313-12810335 CCCGTAGGGTACCCAAAGTCCGG + Intronic
1095095366 12:38145008-38145030 GCCAGTGGGTACCCCGAGTCCGG - Intergenic
1096818187 12:54214965-54214987 CGCTGTGGGAGCCCCGAGTCGGG - Intergenic
1105039341 12:132949524-132949546 CCCGTAGGGTACCCAAAGTCCGG - Intronic
1107247918 13:38319747-38319769 CCCAGCGGGTACCCCGAGTCCGG + Intergenic
1111196260 13:84877275-84877297 CACAGTGGGTACCTTGAGTCTGG - Intergenic
1112322048 13:98416747-98416769 CCAGCTGGGTTCCCCGAGACAGG + Intronic
1115889554 14:38011573-38011595 CCCGGCAGGTTCCCCAAGTCCGG - Intronic
1116683794 14:48011733-48011755 CCCGGCGGGTACCCCGAGTCCGG - Intergenic
1120036801 14:79706978-79707000 CCCGTAGGGTACCCGAAGTCCGG - Intronic
1122967720 14:105139061-105139083 CCCGGTGGTCACCCCTACTCTGG - Intergenic
1126825050 15:52540301-52540323 CCCAGTGGGGACCCAGAGTGGGG + Intergenic
1131179057 15:90227985-90228007 CCCGTTGCGTAGCCAGAGTCGGG - Exonic
1132603571 16:784424-784446 CCCGGTGGGGACTCCGGGTCTGG + Intergenic
1132603593 16:784496-784518 CCCGGTGGGGACTCCGGGTCTGG + Intergenic
1135075937 16:19393607-19393629 CCCAGTGGGTACCCTGAGTCTGG + Intergenic
1137441007 16:48498443-48498465 CCTGGTGGGGGCCCCGAGCCTGG - Intergenic
1144958087 17:19029688-19029710 CCCAGAGGGTAGCCCCAGTCTGG - Intronic
1144977071 17:19144832-19144854 CCCAGAGGGTAGCCCCAGTCTGG + Intronic
1148032146 17:44628749-44628771 CTGGGCTGGTACCCCGAGTCAGG + Intergenic
1148323861 17:46772150-46772172 CCCGGTCGGTGCCCAGAGCCCGG - Intronic
1153388469 18:4527644-4527666 CCCAGCGGGTACCCCGAGTCCGG + Intergenic
1161328750 19:3676223-3676245 CCCGGTGGGGACCATCAGTCGGG - Intronic
1161982535 19:7637396-7637418 CCCTTTGGGTCCCCGGAGTCCGG - Intronic
1162079169 19:8208734-8208756 CACCCTGGGTACCCCGAGTCTGG - Intronic
1165258609 19:34595190-34595212 CCCGTAGGGTACCCGAAGTCTGG + Exonic
1165895625 19:39139354-39139376 CCCGCTGGGTACCCCGACACTGG - Intronic
1166897208 19:46031421-46031443 CCCGTAGGGTACCCAAAGTCCGG - Intergenic
1168147906 19:54429972-54429994 CCCGGTGGGTCCGCCGGGTTGGG + Intronic
928098995 2:28423810-28423832 CACGGTGGGTACCCAGAGCTGGG - Intergenic
933066809 2:77808138-77808160 CCCAGTGGGTACCCCAAGTCCGG - Intergenic
933362355 2:81304456-81304478 CCCAGCTGGTACCCCAAGTCCGG + Intergenic
933418910 2:82023196-82023218 CCCAGTGGGTACCCTGAGTCTGG - Intergenic
933419855 2:82031232-82031254 CCCAGTGGGTACCCTGAGTCTGG - Intergenic
937715155 2:125024234-125024256 CCCAGTGGGTACCCTGAGTCCGG + Intergenic
937862574 2:126722551-126722573 CCCTGGGGATTCCCCGAGTCTGG + Intergenic
942830989 2:180237390-180237412 CCCAGCGGGTACCCGGAGTCTGG - Intergenic
943833208 2:192487900-192487922 CCCAGCGGGTACCCCGAGTCCGG - Intergenic
943960439 2:194256185-194256207 CCCGGCCGGTACCCCGAGTCCGG + Intergenic
947859430 2:233348311-233348333 CCCGGTGGGTACCTCAGGGCAGG - Intergenic
1169083029 20:2809078-2809100 CCTAGCGGTTACCCCGAGTCCGG + Intergenic
1184548333 22:45189239-45189261 CCCGTAGGGTACCCGAAGTCTGG - Intergenic
950215197 3:11154228-11154250 CCCGCTGGGTACCCGGGCTCGGG - Intronic
951999786 3:28772315-28772337 CCCACTGGGTACTCCTAGTCAGG - Intergenic
955419793 3:58724789-58724811 CCCGTAGGGTACCCGAAGTCCGG - Intronic
957694551 3:83618435-83618457 CCCAGCGGGTACTCCGAGTCCGG + Intergenic
957738634 3:84233868-84233890 CCCAGTGGGAACCCCGTGTGGGG + Intergenic
964201238 3:154121455-154121477 CCCCGTGGGTGGCCCGGGTCCGG - Intronic
968653036 4:1767486-1767508 CCCGGTGGGGACACCGAGGCCGG - Intergenic
976306544 4:83565694-83565716 CCCGGTGGGTACCCCGAGTCCGG + Intronic
979126607 4:116980760-116980782 CCCAGCGGGTACCCCGAGTCCGG - Intergenic
981354962 4:143778284-143778306 CCCGTAGGGTACCCAAAGTCTGG - Intergenic
983327431 4:166274578-166274600 CCCAGCGGGTACCCCGAGTCCGG - Intergenic
998150794 5:139756383-139756405 CCTGGTGGGTGCCCCGACCCCGG - Intergenic
1005721674 6:28608400-28608422 CCCGTAGGGTACCCAAAGTCCGG - Intronic
1008236485 6:49057686-49057708 CCCAGTGGGTACCCAGTGTGGGG + Intergenic
1011820201 6:91244577-91244599 CCCTCTGGGAACCCCCAGTCTGG - Intergenic
1019509959 7:1412873-1412895 ACCGGTGCGCACCCCGCGTCTGG + Intergenic
1020939216 7:14509780-14509802 CCCAGCAGGTACCCCGAGTCTGG - Intronic
1028192262 7:87867028-87867050 CCCAGTGGGTACCCCAAGTCTGG - Intronic
1029278260 7:99420335-99420357 CCCGCTGGGTACCCTGGGGCAGG + Intronic
1033125026 7:138699875-138699897 CCGGGTGGGTCCCCGGTGTCAGG + Intronic
1033669104 7:143472697-143472719 CCCAGCGGGTACTCCGAGTCCGG - Intergenic
1036683932 8:10895702-10895724 CCCGAGGGGACCCCCGAGTCAGG + Intergenic
1040138433 8:43882515-43882537 CCCCGTGGGTGCCCCTAGTCTGG + Intergenic
1040787072 8:51178618-51178640 CCCAGAGGGTACCCTGAGTCTGG + Intergenic
1042643134 8:70956668-70956690 GCCTGTTGGTACCCCAAGTCTGG + Intergenic
1043295335 8:78654629-78654651 CCCAGTGTGTACCCCAAGTCCGG - Intergenic
1049637591 8:143697400-143697422 CCCGGGGGGTACCGCGACTGTGG - Intronic
1056154030 9:83817498-83817520 CCCGGTGAGTACGCGGAGGCGGG - Exonic
1056356469 9:85805595-85805617 CCCGGTGAGTACGCGGAGGCGGG + Intergenic
1056593411 9:87984170-87984192 CCCGTAGGGTACCCAAAGTCCGG + Intergenic
1057068645 9:92077150-92077172 CCCGGTGGGTTCCCAGGGTGTGG - Intronic
1195295217 X:103469896-103469918 CCCGTAGGGTACCCAAAGTCCGG + Intergenic
1201776467 Y:17671239-17671261 CCCAGTGGGTACACTGACTCTGG + Intergenic
1201783215 Y:17745357-17745379 CCCAGTGGGTACCCTGAGTCTGG - Intergenic
1201818338 Y:18160630-18160652 CCCAGTGGGTACCCTGAGTCTGG + Intergenic
1201825089 Y:18234753-18234775 CCCAGTGGGTACACTGACTCTGG - Intergenic
1202113909 Y:21451813-21451835 TCCGGCAGGTACCCCGAGTCCGG + Intergenic
1202174576 Y:22085606-22085628 CCCAGTGGGTACCCCGAATCTGG - Intronic
1202216784 Y:22500776-22500798 CCCAGTGTGTACCCCGAATCTGG + Intronic
1202326403 Y:23695294-23695316 CCCAGTGTGTACCCCGAATCTGG - Intergenic
1202544369 Y:25974760-25974782 CCCAGTGGGTACCCCGAATCTGG + Intergenic