ID: 976306544

View in Genome Browser
Species Human (GRCh38)
Location 4:83565694-83565716
Sequence CCCGGTGGGTACCCCGAGTC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 2, 2: 17, 3: 18, 4: 64}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976306533_976306544 17 Left 976306533 4:83565654-83565676 CCAGGCTAATTTTTGTGTTGGGG 0: 1
1: 4
2: 57
3: 1182
4: 16339
Right 976306544 4:83565694-83565716 CCCGGTGGGTACCCCGAGTCCGG 0: 1
1: 2
2: 17
3: 18
4: 64
976306530_976306544 25 Left 976306530 4:83565646-83565668 CCATCATGCCAGGCTAATTTTTG 0: 110
1: 3863
2: 40568
3: 119482
4: 199091
Right 976306544 4:83565694-83565716 CCCGGTGGGTACCCCGAGTCCGG 0: 1
1: 2
2: 17
3: 18
4: 64
976306529_976306544 29 Left 976306529 4:83565642-83565664 CCTGCCATCATGCCAGGCTAATT 0: 49
1: 1662
2: 21399
3: 63489
4: 85301
Right 976306544 4:83565694-83565716 CCCGGTGGGTACCCCGAGTCCGG 0: 1
1: 2
2: 17
3: 18
4: 64
976306537_976306544 -9 Left 976306537 4:83565680-83565702 CCAGCCCCACACCACCCGGTGGG 0: 3
1: 14
2: 34
3: 47
4: 288
Right 976306544 4:83565694-83565716 CCCGGTGGGTACCCCGAGTCCGG 0: 1
1: 2
2: 17
3: 18
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976306544 Original CRISPR CCCGGTGGGTACCCCGAGTC CGG Intronic