ID: 976311801

View in Genome Browser
Species Human (GRCh38)
Location 4:83620542-83620564
Sequence CTGGTGTTCTTGTAAAAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976311801_976311803 -8 Left 976311801 4:83620542-83620564 CCTTTTTTTTACAAGAACACCAG No data
Right 976311803 4:83620557-83620579 AACACCAGTCATATTGGATTAGG 0: 45
1: 352
2: 1023
3: 1828
4: 2206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976311801 Original CRISPR CTGGTGTTCTTGTAAAAAAA AGG (reversed) Intergenic
No off target data available for this crispr