ID: 976315670

View in Genome Browser
Species Human (GRCh38)
Location 4:83656347-83656369
Sequence AACCTAGCACTGCTACTTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976315670_976315673 5 Left 976315670 4:83656347-83656369 CCAATAAGTAGCAGTGCTAGGTT No data
Right 976315673 4:83656375-83656397 CTCAGGCATGAAAAGCAAAAGGG No data
976315670_976315672 4 Left 976315670 4:83656347-83656369 CCAATAAGTAGCAGTGCTAGGTT No data
Right 976315672 4:83656374-83656396 ACTCAGGCATGAAAAGCAAAAGG No data
976315670_976315674 11 Left 976315670 4:83656347-83656369 CCAATAAGTAGCAGTGCTAGGTT No data
Right 976315674 4:83656381-83656403 CATGAAAAGCAAAAGGGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976315670 Original CRISPR AACCTAGCACTGCTACTTAT TGG (reversed) Intergenic
No off target data available for this crispr