ID: 976315993

View in Genome Browser
Species Human (GRCh38)
Location 4:83659724-83659746
Sequence CTTAATAAGCAAGAGCAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976315988_976315993 4 Left 976315988 4:83659697-83659719 CCAAGATGAACATGGCCCTAATC No data
Right 976315993 4:83659724-83659746 CTTAATAAGCAAGAGCAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976315993 Original CRISPR CTTAATAAGCAAGAGCAGGA AGG Intergenic
No off target data available for this crispr