ID: 976317133

View in Genome Browser
Species Human (GRCh38)
Location 4:83670523-83670545
Sequence GGAGTGATAGGACCACAACT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976317128_976317133 -2 Left 976317128 4:83670502-83670524 CCTGAGGTGACCAGATATCCTGG No data
Right 976317133 4:83670523-83670545 GGAGTGATAGGACCACAACTAGG No data
976317127_976317133 -1 Left 976317127 4:83670501-83670523 CCCTGAGGTGACCAGATATCCTG No data
Right 976317133 4:83670523-83670545 GGAGTGATAGGACCACAACTAGG No data
976317126_976317133 5 Left 976317126 4:83670495-83670517 CCTTAACCCTGAGGTGACCAGAT No data
Right 976317133 4:83670523-83670545 GGAGTGATAGGACCACAACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976317133 Original CRISPR GGAGTGATAGGACCACAACT AGG Intergenic
No off target data available for this crispr