ID: 976324235

View in Genome Browser
Species Human (GRCh38)
Location 4:83752616-83752638
Sequence GATGGTGCCGGTGCACATTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976324235_976324248 21 Left 976324235 4:83752616-83752638 CCTCAATGTGCACCGGCACCATC No data
Right 976324248 4:83752660-83752682 AGAACAAAAAGGTGAAGGAAGGG No data
976324235_976324243 -4 Left 976324235 4:83752616-83752638 CCTCAATGTGCACCGGCACCATC No data
Right 976324243 4:83752635-83752657 CATCCAATTGGCTGGGGGTCTGG No data
976324235_976324246 16 Left 976324235 4:83752616-83752638 CCTCAATGTGCACCGGCACCATC No data
Right 976324246 4:83752655-83752677 TGGATAGAACAAAAAGGTGAAGG No data
976324235_976324245 10 Left 976324235 4:83752616-83752638 CCTCAATGTGCACCGGCACCATC No data
Right 976324245 4:83752649-83752671 GGGGTCTGGATAGAACAAAAAGG No data
976324235_976324241 -9 Left 976324235 4:83752616-83752638 CCTCAATGTGCACCGGCACCATC No data
Right 976324241 4:83752630-83752652 GGCACCATCCAATTGGCTGGGGG No data
976324235_976324240 -10 Left 976324235 4:83752616-83752638 CCTCAATGTGCACCGGCACCATC No data
Right 976324240 4:83752629-83752651 CGGCACCATCCAATTGGCTGGGG No data
976324235_976324247 20 Left 976324235 4:83752616-83752638 CCTCAATGTGCACCGGCACCATC No data
Right 976324247 4:83752659-83752681 TAGAACAAAAAGGTGAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976324235 Original CRISPR GATGGTGCCGGTGCACATTG AGG (reversed) Intergenic