ID: 976331377

View in Genome Browser
Species Human (GRCh38)
Location 4:83834713-83834735
Sequence CTTTAGCCACAGATGCATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976331376_976331377 -7 Left 976331376 4:83834697-83834719 CCACAGGTACATTTGGCTTTAGC No data
Right 976331377 4:83834713-83834735 CTTTAGCCACAGATGCATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976331377 Original CRISPR CTTTAGCCACAGATGCATCT TGG Intergenic
No off target data available for this crispr