ID: 976337790

View in Genome Browser
Species Human (GRCh38)
Location 4:83910894-83910916
Sequence CAGCTGTTCTTGTGCATACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976337787_976337790 0 Left 976337787 4:83910871-83910893 CCCAACAGCTGTGTTTGTGTTTG No data
Right 976337790 4:83910894-83910916 CAGCTGTTCTTGTGCATACAGGG No data
976337788_976337790 -1 Left 976337788 4:83910872-83910894 CCAACAGCTGTGTTTGTGTTTGC No data
Right 976337790 4:83910894-83910916 CAGCTGTTCTTGTGCATACAGGG No data
976337786_976337790 8 Left 976337786 4:83910863-83910885 CCATTAAACCCAACAGCTGTGTT No data
Right 976337790 4:83910894-83910916 CAGCTGTTCTTGTGCATACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976337790 Original CRISPR CAGCTGTTCTTGTGCATACA GGG Intergenic
No off target data available for this crispr