ID: 976346889

View in Genome Browser
Species Human (GRCh38)
Location 4:84013978-84014000
Sequence AGCTGTACACAGATGAGTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976346885_976346889 21 Left 976346885 4:84013934-84013956 CCATGGGAACGAAAAGGTTTCAG No data
Right 976346889 4:84013978-84014000 AGCTGTACACAGATGAGTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976346889 Original CRISPR AGCTGTACACAGATGAGTTA AGG Intergenic
No off target data available for this crispr