ID: 976346889 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 4:84013978-84014000 |
Sequence | AGCTGTACACAGATGAGTTA AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
976346885_976346889 | 21 | Left | 976346885 | 4:84013934-84013956 | CCATGGGAACGAAAAGGTTTCAG | No data | ||
Right | 976346889 | 4:84013978-84014000 | AGCTGTACACAGATGAGTTAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
976346889 | Original CRISPR | AGCTGTACACAGATGAGTTA AGG | Intergenic | ||
No off target data available for this crispr |