ID: 976347341

View in Genome Browser
Species Human (GRCh38)
Location 4:84019731-84019753
Sequence GTTTTCAGTAGACTACAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976347339_976347341 -10 Left 976347339 4:84019718-84019740 CCCAGTTCACATTGTTTTCAGTA No data
Right 976347341 4:84019731-84019753 GTTTTCAGTAGACTACAAGCAGG No data
976347337_976347341 15 Left 976347337 4:84019693-84019715 CCTTTGCCTGGAGCAAAAAAAAA No data
Right 976347341 4:84019731-84019753 GTTTTCAGTAGACTACAAGCAGG No data
976347338_976347341 9 Left 976347338 4:84019699-84019721 CCTGGAGCAAAAAAAAAATCCCA No data
Right 976347341 4:84019731-84019753 GTTTTCAGTAGACTACAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976347341 Original CRISPR GTTTTCAGTAGACTACAAGC AGG Intergenic
No off target data available for this crispr