ID: 976349286

View in Genome Browser
Species Human (GRCh38)
Location 4:84042630-84042652
Sequence GCTATAACATAGCCATGCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976349284_976349286 -1 Left 976349284 4:84042608-84042630 CCAACTGGGTGAAAATAAACCTG No data
Right 976349286 4:84042630-84042652 GCTATAACATAGCCATGCTGTGG No data
976349283_976349286 0 Left 976349283 4:84042607-84042629 CCCAACTGGGTGAAAATAAACCT No data
Right 976349286 4:84042630-84042652 GCTATAACATAGCCATGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976349286 Original CRISPR GCTATAACATAGCCATGCTG TGG Intergenic
No off target data available for this crispr