ID: 976350195

View in Genome Browser
Species Human (GRCh38)
Location 4:84051982-84052004
Sequence CCGTTGTTCCTTAGGAAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976350192_976350195 2 Left 976350192 4:84051957-84051979 CCAGGGAGGAGTTTTTTTGTCTA No data
Right 976350195 4:84051982-84052004 CCGTTGTTCCTTAGGAAAAAAGG No data
976350191_976350195 3 Left 976350191 4:84051956-84051978 CCCAGGGAGGAGTTTTTTTGTCT No data
Right 976350195 4:84051982-84052004 CCGTTGTTCCTTAGGAAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976350195 Original CRISPR CCGTTGTTCCTTAGGAAAAA AGG Intergenic
No off target data available for this crispr