ID: 976356399

View in Genome Browser
Species Human (GRCh38)
Location 4:84122671-84122693
Sequence CCGCAGGAGGAGAGGCCCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976356399_976356404 -2 Left 976356399 4:84122671-84122693 CCTCAGGGCCTCTCCTCCTGCGG No data
Right 976356404 4:84122692-84122714 GGCTTCTCAATCAAGAAAGTTGG No data
976356399_976356405 20 Left 976356399 4:84122671-84122693 CCTCAGGGCCTCTCCTCCTGCGG No data
Right 976356405 4:84122714-84122736 GACTTCGTACATGCCAAATCTGG No data
976356399_976356406 21 Left 976356399 4:84122671-84122693 CCTCAGGGCCTCTCCTCCTGCGG No data
Right 976356406 4:84122715-84122737 ACTTCGTACATGCCAAATCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976356399 Original CRISPR CCGCAGGAGGAGAGGCCCTG AGG (reversed) Intergenic
No off target data available for this crispr